ID: 943066195

View in Genome Browser
Species Human (GRCh38)
Location 2:183089307-183089329
Sequence TCTTTGTACTGCCTGTCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943066195_943066204 22 Left 943066195 2:183089307-183089329 CCTCTGGACAGGCAGTACAAAGA No data
Right 943066204 2:183089352-183089374 GAAGGGAGGATTTATCTGCCTGG No data
943066195_943066198 5 Left 943066195 2:183089307-183089329 CCTCTGGACAGGCAGTACAAAGA No data
Right 943066198 2:183089335-183089357 CACCTCAACCCAGCCTGGAAGGG No data
943066195_943066197 4 Left 943066195 2:183089307-183089329 CCTCTGGACAGGCAGTACAAAGA No data
Right 943066197 2:183089334-183089356 GCACCTCAACCCAGCCTGGAAGG No data
943066195_943066200 8 Left 943066195 2:183089307-183089329 CCTCTGGACAGGCAGTACAAAGA No data
Right 943066200 2:183089338-183089360 CTCAACCCAGCCTGGAAGGGAGG No data
943066195_943066196 0 Left 943066195 2:183089307-183089329 CCTCTGGACAGGCAGTACAAAGA No data
Right 943066196 2:183089330-183089352 AACTGCACCTCAACCCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943066195 Original CRISPR TCTTTGTACTGCCTGTCCAG AGG (reversed) Intronic
No off target data available for this crispr