ID: 943066198

View in Genome Browser
Species Human (GRCh38)
Location 2:183089335-183089357
Sequence CACCTCAACCCAGCCTGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943066191_943066198 17 Left 943066191 2:183089295-183089317 CCACCCAAAATACCTCTGGACAG No data
Right 943066198 2:183089335-183089357 CACCTCAACCCAGCCTGGAAGGG No data
943066195_943066198 5 Left 943066195 2:183089307-183089329 CCTCTGGACAGGCAGTACAAAGA No data
Right 943066198 2:183089335-183089357 CACCTCAACCCAGCCTGGAAGGG No data
943066194_943066198 13 Left 943066194 2:183089299-183089321 CCAAAATACCTCTGGACAGGCAG No data
Right 943066198 2:183089335-183089357 CACCTCAACCCAGCCTGGAAGGG No data
943066193_943066198 14 Left 943066193 2:183089298-183089320 CCCAAAATACCTCTGGACAGGCA No data
Right 943066198 2:183089335-183089357 CACCTCAACCCAGCCTGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943066198 Original CRISPR CACCTCAACCCAGCCTGGAA GGG Intronic
No off target data available for this crispr