ID: 943066204

View in Genome Browser
Species Human (GRCh38)
Location 2:183089352-183089374
Sequence GAAGGGAGGATTTATCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943066195_943066204 22 Left 943066195 2:183089307-183089329 CCTCTGGACAGGCAGTACAAAGA No data
Right 943066204 2:183089352-183089374 GAAGGGAGGATTTATCTGCCTGG No data
943066199_943066204 -8 Left 943066199 2:183089337-183089359 CCTCAACCCAGCCTGGAAGGGAG No data
Right 943066204 2:183089352-183089374 GAAGGGAGGATTTATCTGCCTGG No data
943066194_943066204 30 Left 943066194 2:183089299-183089321 CCAAAATACCTCTGGACAGGCAG No data
Right 943066204 2:183089352-183089374 GAAGGGAGGATTTATCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943066204 Original CRISPR GAAGGGAGGATTTATCTGCC TGG Intronic
No off target data available for this crispr