ID: 943067307

View in Genome Browser
Species Human (GRCh38)
Location 2:183102101-183102123
Sequence AGGTTGCCCATTCACTCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 17132
Summary {0: 1, 1: 29, 2: 418, 3: 12265, 4: 4419}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943067303_943067307 21 Left 943067303 2:183102057-183102079 CCTTTGTCAGATGGCTAGATTGC 0: 41
1: 4329
2: 8148
3: 12517
4: 7957
Right 943067307 2:183102101-183102123 AGGTTGCCCATTCACTCTCATGG 0: 1
1: 29
2: 418
3: 12265
4: 4419

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943067307 Original CRISPR AGGTTGCCCATTCACTCTCA TGG Intergenic
Too many off-targets to display for this crispr