ID: 943071294

View in Genome Browser
Species Human (GRCh38)
Location 2:183143489-183143511
Sequence TGGTGTTCTGAATATGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943071287_943071294 17 Left 943071287 2:183143449-183143471 CCAAAGAAGAATCTTTTAATACT No data
Right 943071294 2:183143489-183143511 TGGTGTTCTGAATATGGGCAGGG No data
943071286_943071294 18 Left 943071286 2:183143448-183143470 CCCAAAGAAGAATCTTTTAATAC No data
Right 943071294 2:183143489-183143511 TGGTGTTCTGAATATGGGCAGGG No data
943071289_943071294 -9 Left 943071289 2:183143475-183143497 CCTTATGCCTAAGCTGGTGTTCT No data
Right 943071294 2:183143489-183143511 TGGTGTTCTGAATATGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943071294 Original CRISPR TGGTGTTCTGAATATGGGCA GGG Intronic
No off target data available for this crispr