ID: 943071719

View in Genome Browser
Species Human (GRCh38)
Location 2:183148965-183148987
Sequence GATTATCTATAGAAGGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943071719_943071725 4 Left 943071719 2:183148965-183148987 CCCCCCACCTTCTATAGATAATC No data
Right 943071725 2:183148992-183149014 TTGTTTCTTAAGAACATACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943071719 Original CRISPR GATTATCTATAGAAGGTGGG GGG (reversed) Intronic
No off target data available for this crispr