ID: 943074826

View in Genome Browser
Species Human (GRCh38)
Location 2:183180990-183181012
Sequence TCATTGCCTCAGATGGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943074826_943074830 18 Left 943074826 2:183180990-183181012 CCTACCTCCATCTGAGGCAATGA No data
Right 943074830 2:183181031-183181053 AGAACTGCTCCAATCAGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943074826 Original CRISPR TCATTGCCTCAGATGGAGGT AGG (reversed) Intergenic
No off target data available for this crispr