ID: 943075184

View in Genome Browser
Species Human (GRCh38)
Location 2:183185897-183185919
Sequence GCTCCCTAGAAACTGCACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943075184_943075188 13 Left 943075184 2:183185897-183185919 CCTTTGTGCAGTTTCTAGGGAGC No data
Right 943075188 2:183185933-183185955 CTCAGGGCTAGTGAATGTTGAGG No data
943075184_943075191 26 Left 943075184 2:183185897-183185919 CCTTTGTGCAGTTTCTAGGGAGC No data
Right 943075191 2:183185946-183185968 AATGTTGAGGGGCTCTCCTGAGG No data
943075184_943075189 14 Left 943075184 2:183185897-183185919 CCTTTGTGCAGTTTCTAGGGAGC No data
Right 943075189 2:183185934-183185956 TCAGGGCTAGTGAATGTTGAGGG No data
943075184_943075190 15 Left 943075184 2:183185897-183185919 CCTTTGTGCAGTTTCTAGGGAGC No data
Right 943075190 2:183185935-183185957 CAGGGCTAGTGAATGTTGAGGGG No data
943075184_943075186 -3 Left 943075184 2:183185897-183185919 CCTTTGTGCAGTTTCTAGGGAGC No data
Right 943075186 2:183185917-183185939 AGCTTCTTTTGTTAGCCTCAGGG No data
943075184_943075185 -4 Left 943075184 2:183185897-183185919 CCTTTGTGCAGTTTCTAGGGAGC No data
Right 943075185 2:183185916-183185938 GAGCTTCTTTTGTTAGCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943075184 Original CRISPR GCTCCCTAGAAACTGCACAA AGG (reversed) Intergenic
No off target data available for this crispr