ID: 943078276

View in Genome Browser
Species Human (GRCh38)
Location 2:183225021-183225043
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943078276_943078279 2 Left 943078276 2:183225021-183225043 CCTGGGTAAGGACACATTAGATT No data
Right 943078279 2:183225046-183225068 TTTCTGTGGGCATGTCTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943078276 Original CRISPR AATCTAATGTGTCCTTACCC AGG (reversed) Intergenic
No off target data available for this crispr