ID: 943079128

View in Genome Browser
Species Human (GRCh38)
Location 2:183236207-183236229
Sequence CAGTGTAAACAGAAAGAATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943079125_943079128 2 Left 943079125 2:183236182-183236204 CCAGTGGCTCCAAAAAGGTACAA No data
Right 943079128 2:183236207-183236229 CAGTGTAAACAGAAAGAATAGGG No data
943079126_943079128 -7 Left 943079126 2:183236191-183236213 CCAAAAAGGTACAACTCAGTGTA No data
Right 943079128 2:183236207-183236229 CAGTGTAAACAGAAAGAATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943079128 Original CRISPR CAGTGTAAACAGAAAGAATA GGG Intergenic
No off target data available for this crispr