ID: 943085975

View in Genome Browser
Species Human (GRCh38)
Location 2:183311697-183311719
Sequence ATTTGCTTTTGGAAGTGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943085972_943085975 30 Left 943085972 2:183311644-183311666 CCATGAAATATCATGGAATATTT No data
Right 943085975 2:183311697-183311719 ATTTGCTTTTGGAAGTGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943085975 Original CRISPR ATTTGCTTTTGGAAGTGTGT TGG Intergenic
No off target data available for this crispr