ID: 943088164

View in Genome Browser
Species Human (GRCh38)
Location 2:183340592-183340614
Sequence ATGGAGAAGAAGGTTCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943088164_943088173 5 Left 943088164 2:183340592-183340614 CCCTCCTGAACCTTCTTCTCCAT No data
Right 943088173 2:183340620-183340642 AGTAATAAATTGGGGTGAGGTGG No data
943088164_943088176 22 Left 943088164 2:183340592-183340614 CCCTCCTGAACCTTCTTCTCCAT No data
Right 943088176 2:183340637-183340659 AGGTGGTTGGGAGAAACAGATGG No data
943088164_943088172 2 Left 943088164 2:183340592-183340614 CCCTCCTGAACCTTCTTCTCCAT No data
Right 943088172 2:183340617-183340639 TATAGTAATAAATTGGGGTGAGG No data
943088164_943088175 10 Left 943088164 2:183340592-183340614 CCCTCCTGAACCTTCTTCTCCAT No data
Right 943088175 2:183340625-183340647 TAAATTGGGGTGAGGTGGTTGGG No data
943088164_943088177 26 Left 943088164 2:183340592-183340614 CCCTCCTGAACCTTCTTCTCCAT No data
Right 943088177 2:183340641-183340663 GGTTGGGAGAAACAGATGGTAGG No data
943088164_943088171 -3 Left 943088164 2:183340592-183340614 CCCTCCTGAACCTTCTTCTCCAT No data
Right 943088171 2:183340612-183340634 CATTTTATAGTAATAAATTGGGG No data
943088164_943088170 -4 Left 943088164 2:183340592-183340614 CCCTCCTGAACCTTCTTCTCCAT No data
Right 943088170 2:183340611-183340633 CCATTTTATAGTAATAAATTGGG No data
943088164_943088168 -5 Left 943088164 2:183340592-183340614 CCCTCCTGAACCTTCTTCTCCAT No data
Right 943088168 2:183340610-183340632 TCCATTTTATAGTAATAAATTGG No data
943088164_943088178 27 Left 943088164 2:183340592-183340614 CCCTCCTGAACCTTCTTCTCCAT No data
Right 943088178 2:183340642-183340664 GTTGGGAGAAACAGATGGTAGGG No data
943088164_943088174 9 Left 943088164 2:183340592-183340614 CCCTCCTGAACCTTCTTCTCCAT No data
Right 943088174 2:183340624-183340646 ATAAATTGGGGTGAGGTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943088164 Original CRISPR ATGGAGAAGAAGGTTCAGGA GGG (reversed) Intergenic
No off target data available for this crispr