ID: 943090729

View in Genome Browser
Species Human (GRCh38)
Location 2:183371769-183371791
Sequence CTGTAGACAGAGTTGGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943090729_943090734 26 Left 943090729 2:183371769-183371791 CCCTGCACCAACTCTGTCTACAG No data
Right 943090734 2:183371818-183371840 AGATATTTTTTTTTAAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943090729 Original CRISPR CTGTAGACAGAGTTGGTGCA GGG (reversed) Intergenic
No off target data available for this crispr