ID: 943099656

View in Genome Browser
Species Human (GRCh38)
Location 2:183472223-183472245
Sequence AGGGAGAGTGCAGTGACTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943099656_943099666 27 Left 943099656 2:183472223-183472245 CCCATAGTCACTGCACTCTCCCT No data
Right 943099666 2:183472273-183472295 TGCCACGCCACCATTGCTGGTGG No data
943099656_943099665 24 Left 943099656 2:183472223-183472245 CCCATAGTCACTGCACTCTCCCT No data
Right 943099665 2:183472270-183472292 CTCTGCCACGCCACCATTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943099656 Original CRISPR AGGGAGAGTGCAGTGACTAT GGG (reversed) Intergenic
No off target data available for this crispr