ID: 943101813

View in Genome Browser
Species Human (GRCh38)
Location 2:183496083-183496105
Sequence TGCAGCTGAGCAAGTTCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943101812_943101813 -7 Left 943101812 2:183496067-183496089 CCTGAGGTGCAGTCGCTGCAGCT No data
Right 943101813 2:183496083-183496105 TGCAGCTGAGCAAGTTCAGAAGG No data
943101811_943101813 -3 Left 943101811 2:183496063-183496085 CCTGCCTGAGGTGCAGTCGCTGC No data
Right 943101813 2:183496083-183496105 TGCAGCTGAGCAAGTTCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943101813 Original CRISPR TGCAGCTGAGCAAGTTCAGA AGG Intergenic
No off target data available for this crispr