ID: 943101845

View in Genome Browser
Species Human (GRCh38)
Location 2:183496443-183496465
Sequence CATCATGCCGGGAGTTGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943101845_943101851 27 Left 943101845 2:183496443-183496465 CCAACTCAACTCCCGGCATGATG No data
Right 943101851 2:183496493-183496515 CTAAAAATGTGGCTTCTCACCGG No data
943101845_943101849 16 Left 943101845 2:183496443-183496465 CCAACTCAACTCCCGGCATGATG No data
Right 943101849 2:183496482-183496504 TTCCTCAACTTCTAAAAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943101845 Original CRISPR CATCATGCCGGGAGTTGAGT TGG (reversed) Intergenic
No off target data available for this crispr