ID: 943101845 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:183496443-183496465 |
| Sequence | CATCATGCCGGGAGTTGAGT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 943101845_943101851 | 27 | Left | 943101845 | 2:183496443-183496465 | CCAACTCAACTCCCGGCATGATG | No data | ||
| Right | 943101851 | 2:183496493-183496515 | CTAAAAATGTGGCTTCTCACCGG | No data | ||||
| 943101845_943101849 | 16 | Left | 943101845 | 2:183496443-183496465 | CCAACTCAACTCCCGGCATGATG | No data | ||
| Right | 943101849 | 2:183496482-183496504 | TTCCTCAACTTCTAAAAATGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 943101845 | Original CRISPR | CATCATGCCGGGAGTTGAGT TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||