ID: 943102479

View in Genome Browser
Species Human (GRCh38)
Location 2:183505172-183505194
Sequence GTTCAGCAGCATCATGCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943102479_943102481 24 Left 943102479 2:183505172-183505194 CCAACAGCATGATGCTGCTGAAC No data
Right 943102481 2:183505219-183505241 AGCTACAGAGCAGAGTTCTTAGG No data
943102479_943102480 -7 Left 943102479 2:183505172-183505194 CCAACAGCATGATGCTGCTGAAC No data
Right 943102480 2:183505188-183505210 GCTGAACAACTGCTCTGATTTGG No data
943102479_943102482 25 Left 943102479 2:183505172-183505194 CCAACAGCATGATGCTGCTGAAC No data
Right 943102482 2:183505220-183505242 GCTACAGAGCAGAGTTCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943102479 Original CRISPR GTTCAGCAGCATCATGCTGT TGG (reversed) Intergenic