ID: 943104342

View in Genome Browser
Species Human (GRCh38)
Location 2:183525888-183525910
Sequence CTGAATATAAATAGGGACTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943104342_943104346 16 Left 943104342 2:183525888-183525910 CCATAGTCCCTATTTATATTCAG No data
Right 943104346 2:183525927-183525949 TTTATGGCAGAAATTTAACAAGG No data
943104342_943104345 0 Left 943104342 2:183525888-183525910 CCATAGTCCCTATTTATATTCAG No data
Right 943104345 2:183525911-183525933 CTTTTACTAAAACACATTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943104342 Original CRISPR CTGAATATAAATAGGGACTA TGG (reversed) Intergenic
No off target data available for this crispr