ID: 943106185

View in Genome Browser
Species Human (GRCh38)
Location 2:183546975-183546997
Sequence TCGTGCTGGCCTGCAAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943106178_943106185 0 Left 943106178 2:183546952-183546974 CCAAGGCCACGCCCACCCGGAAC No data
Right 943106185 2:183546975-183546997 TCGTGCTGGCCTGCAAGCCCAGG No data
943106172_943106185 29 Left 943106172 2:183546923-183546945 CCAGCTGGCTGCTCTGAGTGCAG No data
Right 943106185 2:183546975-183546997 TCGTGCTGGCCTGCAAGCCCAGG No data
943106176_943106185 4 Left 943106176 2:183546948-183546970 CCTGCCAAGGCCACGCCCACCCG No data
Right 943106185 2:183546975-183546997 TCGTGCTGGCCTGCAAGCCCAGG No data
943106179_943106185 -6 Left 943106179 2:183546958-183546980 CCACGCCCACCCGGAACTCGTGC 0: 22
1: 171
2: 810
3: 713
4: 478
Right 943106185 2:183546975-183546997 TCGTGCTGGCCTGCAAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943106185 Original CRISPR TCGTGCTGGCCTGCAAGCCC AGG Intergenic
No off target data available for this crispr