ID: 943111481

View in Genome Browser
Species Human (GRCh38)
Location 2:183611401-183611423
Sequence GGGTGAGAAAGTGCATCTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943111472_943111481 18 Left 943111472 2:183611360-183611382 CCTGCTTCAGTGTCCTGGGGTCA No data
Right 943111481 2:183611401-183611423 GGGTGAGAAAGTGCATCTAGGGG No data
943111475_943111481 5 Left 943111475 2:183611373-183611395 CCTGGGGTCATTTACATGGGTGG No data
Right 943111481 2:183611401-183611423 GGGTGAGAAAGTGCATCTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943111481 Original CRISPR GGGTGAGAAAGTGCATCTAG GGG Intergenic
No off target data available for this crispr