ID: 943114019

View in Genome Browser
Species Human (GRCh38)
Location 2:183643894-183643916
Sequence CTTCAAGTTCTGCAGGCATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943114019_943114027 26 Left 943114019 2:183643894-183643916 CCTTATGCCTGCAGAACTTGAAG No data
Right 943114027 2:183643943-183643965 ATTAGAAGGGAGGCGGAGGGAGG No data
943114019_943114025 22 Left 943114019 2:183643894-183643916 CCTTATGCCTGCAGAACTTGAAG No data
Right 943114025 2:183643939-183643961 CAAAATTAGAAGGGAGGCGGAGG No data
943114019_943114021 12 Left 943114019 2:183643894-183643916 CCTTATGCCTGCAGAACTTGAAG No data
Right 943114021 2:183643929-183643951 TCTGTGTATGCAAAATTAGAAGG No data
943114019_943114022 13 Left 943114019 2:183643894-183643916 CCTTATGCCTGCAGAACTTGAAG No data
Right 943114022 2:183643930-183643952 CTGTGTATGCAAAATTAGAAGGG No data
943114019_943114026 23 Left 943114019 2:183643894-183643916 CCTTATGCCTGCAGAACTTGAAG No data
Right 943114026 2:183643940-183643962 AAAATTAGAAGGGAGGCGGAGGG No data
943114019_943114023 16 Left 943114019 2:183643894-183643916 CCTTATGCCTGCAGAACTTGAAG No data
Right 943114023 2:183643933-183643955 TGTATGCAAAATTAGAAGGGAGG No data
943114019_943114024 19 Left 943114019 2:183643894-183643916 CCTTATGCCTGCAGAACTTGAAG No data
Right 943114024 2:183643936-183643958 ATGCAAAATTAGAAGGGAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943114019 Original CRISPR CTTCAAGTTCTGCAGGCATA AGG (reversed) Intergenic
No off target data available for this crispr