ID: 943117607

View in Genome Browser
Species Human (GRCh38)
Location 2:183692442-183692464
Sequence AGGGAGAGCACAGTGAATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943117607_943117616 22 Left 943117607 2:183692442-183692464 CCCCCATTCACTGTGCTCTCCCT No data
Right 943117616 2:183692487-183692509 TCTCCACACCACATAGCCACTGG No data
943117607_943117618 27 Left 943117607 2:183692442-183692464 CCCCCATTCACTGTGCTCTCCCT No data
Right 943117618 2:183692492-183692514 ACACCACATAGCCACTGGTGAGG No data
943117607_943117619 28 Left 943117607 2:183692442-183692464 CCCCCATTCACTGTGCTCTCCCT No data
Right 943117619 2:183692493-183692515 CACCACATAGCCACTGGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943117607 Original CRISPR AGGGAGAGCACAGTGAATGG GGG (reversed) Intergenic