ID: 943121264

View in Genome Browser
Species Human (GRCh38)
Location 2:183739069-183739091
Sequence TGTTGGAATTATAGAGATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943121259_943121264 29 Left 943121259 2:183739017-183739039 CCACATAATTTTCAAATATATCT No data
Right 943121264 2:183739069-183739091 TGTTGGAATTATAGAGATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943121264 Original CRISPR TGTTGGAATTATAGAGATCT TGG Intergenic
No off target data available for this crispr