ID: 943127723

View in Genome Browser
Species Human (GRCh38)
Location 2:183816466-183816488
Sequence ACCGGATTGTAAATGTGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943127723_943127726 8 Left 943127723 2:183816466-183816488 CCAAATCACATTTACAATCCGGT No data
Right 943127726 2:183816497-183816519 AATGTAATGTAGAACAGCACAGG No data
943127723_943127731 27 Left 943127723 2:183816466-183816488 CCAAATCACATTTACAATCCGGT No data
Right 943127731 2:183816516-183816538 CAGGGAAGAGGTCTGGGAAATGG No data
943127723_943127727 9 Left 943127723 2:183816466-183816488 CCAAATCACATTTACAATCCGGT No data
Right 943127727 2:183816498-183816520 ATGTAATGTAGAACAGCACAGGG No data
943127723_943127730 21 Left 943127723 2:183816466-183816488 CCAAATCACATTTACAATCCGGT No data
Right 943127730 2:183816510-183816532 ACAGCACAGGGAAGAGGTCTGGG No data
943127723_943127728 15 Left 943127723 2:183816466-183816488 CCAAATCACATTTACAATCCGGT No data
Right 943127728 2:183816504-183816526 TGTAGAACAGCACAGGGAAGAGG No data
943127723_943127729 20 Left 943127723 2:183816466-183816488 CCAAATCACATTTACAATCCGGT No data
Right 943127729 2:183816509-183816531 AACAGCACAGGGAAGAGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943127723 Original CRISPR ACCGGATTGTAAATGTGATT TGG (reversed) Intergenic
No off target data available for this crispr