ID: 943127729

View in Genome Browser
Species Human (GRCh38)
Location 2:183816509-183816531
Sequence AACAGCACAGGGAAGAGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943127723_943127729 20 Left 943127723 2:183816466-183816488 CCAAATCACATTTACAATCCGGT No data
Right 943127729 2:183816509-183816531 AACAGCACAGGGAAGAGGTCTGG No data
943127725_943127729 2 Left 943127725 2:183816484-183816506 CCGGTCTTTGGCAAATGTAATGT No data
Right 943127729 2:183816509-183816531 AACAGCACAGGGAAGAGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943127729 Original CRISPR AACAGCACAGGGAAGAGGTC TGG Intergenic
No off target data available for this crispr