ID: 943132580

View in Genome Browser
Species Human (GRCh38)
Location 2:183872967-183872989
Sequence AAAATTATGTAGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943132580_943132583 11 Left 943132580 2:183872967-183872989 CCTTCCTCCTTCTACATAATTTT No data
Right 943132583 2:183873001-183873023 AGCTTATCTCTGTACTGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943132580 Original CRISPR AAAATTATGTAGAAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr