ID: 943139837

View in Genome Browser
Species Human (GRCh38)
Location 2:183968460-183968482
Sequence AATCTGGACACAGGGTCACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943139837_943139842 21 Left 943139837 2:183968460-183968482 CCCGGTGACCCTGTGTCCAGATT No data
Right 943139842 2:183968504-183968526 GCATTTAAATAGATTGATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943139837 Original CRISPR AATCTGGACACAGGGTCACC GGG (reversed) Intergenic
No off target data available for this crispr