ID: 943139839

View in Genome Browser
Species Human (GRCh38)
Location 2:183968468-183968490
Sequence TTAGCTAAAATCTGGACACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943139839_943139842 13 Left 943139839 2:183968468-183968490 CCCTGTGTCCAGATTTTAGCTAA No data
Right 943139842 2:183968504-183968526 GCATTTAAATAGATTGATAATGG No data
943139839_943139843 23 Left 943139839 2:183968468-183968490 CCCTGTGTCCAGATTTTAGCTAA No data
Right 943139843 2:183968514-183968536 AGATTGATAATGGAGACTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943139839 Original CRISPR TTAGCTAAAATCTGGACACA GGG (reversed) Intergenic
No off target data available for this crispr