ID: 943139841 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:183968476-183968498 |
| Sequence | TCAATCACTTAGCTAAAATC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 943139841_943139843 | 15 | Left | 943139841 | 2:183968476-183968498 | CCAGATTTTAGCTAAGTGATTGA | No data | ||
| Right | 943139843 | 2:183968514-183968536 | AGATTGATAATGGAGACTAATGG | No data | ||||
| 943139841_943139842 | 5 | Left | 943139841 | 2:183968476-183968498 | CCAGATTTTAGCTAAGTGATTGA | No data | ||
| Right | 943139842 | 2:183968504-183968526 | GCATTTAAATAGATTGATAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 943139841 | Original CRISPR | TCAATCACTTAGCTAAAATC TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||