ID: 943139841

View in Genome Browser
Species Human (GRCh38)
Location 2:183968476-183968498
Sequence TCAATCACTTAGCTAAAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943139841_943139843 15 Left 943139841 2:183968476-183968498 CCAGATTTTAGCTAAGTGATTGA No data
Right 943139843 2:183968514-183968536 AGATTGATAATGGAGACTAATGG No data
943139841_943139842 5 Left 943139841 2:183968476-183968498 CCAGATTTTAGCTAAGTGATTGA No data
Right 943139842 2:183968504-183968526 GCATTTAAATAGATTGATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943139841 Original CRISPR TCAATCACTTAGCTAAAATC TGG (reversed) Intergenic
No off target data available for this crispr