ID: 943139842

View in Genome Browser
Species Human (GRCh38)
Location 2:183968504-183968526
Sequence GCATTTAAATAGATTGATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943139838_943139842 20 Left 943139838 2:183968461-183968483 CCGGTGACCCTGTGTCCAGATTT No data
Right 943139842 2:183968504-183968526 GCATTTAAATAGATTGATAATGG No data
943139839_943139842 13 Left 943139839 2:183968468-183968490 CCCTGTGTCCAGATTTTAGCTAA No data
Right 943139842 2:183968504-183968526 GCATTTAAATAGATTGATAATGG No data
943139841_943139842 5 Left 943139841 2:183968476-183968498 CCAGATTTTAGCTAAGTGATTGA No data
Right 943139842 2:183968504-183968526 GCATTTAAATAGATTGATAATGG No data
943139837_943139842 21 Left 943139837 2:183968460-183968482 CCCGGTGACCCTGTGTCCAGATT No data
Right 943139842 2:183968504-183968526 GCATTTAAATAGATTGATAATGG No data
943139840_943139842 12 Left 943139840 2:183968469-183968491 CCTGTGTCCAGATTTTAGCTAAG No data
Right 943139842 2:183968504-183968526 GCATTTAAATAGATTGATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943139842 Original CRISPR GCATTTAAATAGATTGATAA TGG Intergenic
No off target data available for this crispr