ID: 943140107

View in Genome Browser
Species Human (GRCh38)
Location 2:183971568-183971590
Sequence GGGCATTCAATTAGAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943140107_943140111 8 Left 943140107 2:183971568-183971590 CCTGTTTTTCTAATTGAATGCCC No data
Right 943140111 2:183971599-183971621 CTTCTCCTGCCTGATTGCCCTGG 0: 2758
1: 5884
2: 4851
3: 4196
4: 4617

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943140107 Original CRISPR GGGCATTCAATTAGAAAAAC AGG (reversed) Intergenic
No off target data available for this crispr