ID: 943148084

View in Genome Browser
Species Human (GRCh38)
Location 2:184071515-184071537
Sequence CTCAATATAAAGATCAAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943148084_943148086 1 Left 943148084 2:184071515-184071537 CCAAGCTTGATCTTTATATTGAG No data
Right 943148086 2:184071539-184071561 TCCCATTTTGCTTGACAGAAGGG No data
943148084_943148085 0 Left 943148084 2:184071515-184071537 CCAAGCTTGATCTTTATATTGAG No data
Right 943148085 2:184071538-184071560 CTCCCATTTTGCTTGACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943148084 Original CRISPR CTCAATATAAAGATCAAGCT TGG (reversed) Intergenic
No off target data available for this crispr