ID: 943153125

View in Genome Browser
Species Human (GRCh38)
Location 2:184138781-184138803
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 686
Summary {0: 4, 1: 39, 2: 82, 3: 120, 4: 441}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943153125 Original CRISPR CAGCTGGTGTGGAGCCCAGA GGG (reversed) Intergenic
900157019 1:1207177-1207199 GAGCTGGTGGGGAGACGAGAGGG + Intergenic
900505554 1:3028429-3028451 CAGCAGGTGTTGAGCACACAAGG + Intergenic
901167120 1:7229053-7229075 CAGGTGGAGGGGAGCCCAGAGGG + Intronic
901738506 1:11327431-11327453 GAGCTGGGGTGGAGCCAGGATGG + Intergenic
902466036 1:16619414-16619436 CAGCTGGTGAGGAGAGGAGATGG + Intergenic
902508655 1:16953890-16953912 CAGCTGGTGAGGAGAGGAGATGG - Intronic
902968412 1:20029162-20029184 CAGCAGATGTGGAAACCAGAAGG + Intronic
903480192 1:23647400-23647422 CAGCGGCTGTGGACACCAGAAGG - Intergenic
903532993 1:24046373-24046395 CAGCTGGGGTCGAGCCAAGTGGG - Intergenic
903780577 1:25817815-25817837 CATCTGGTCTGGAGGTCAGAGGG - Exonic
904438194 1:30512909-30512931 CAGCTGGTGTGGAGCAGAGGTGG - Intergenic
904439179 1:30518628-30518650 CAGCATGGATGGAGCCCAGATGG + Intergenic
904750823 1:32740849-32740871 CAGCGGGAGAGGAGCCAAGATGG - Intergenic
904995699 1:34629740-34629762 TTGCTGTTGTGGTGCCCAGAGGG - Intergenic
905175628 1:36133864-36133886 GAGCTGGTGAGGAGCTCACATGG - Intergenic
905473204 1:38208169-38208191 CTGCTGGGATGGAGACCAGAGGG + Intergenic
906522668 1:46476701-46476723 CTCCTGTTGTGAAGCCCAGAAGG - Intergenic
906851039 1:49250897-49250919 CAGCTGATGTGGAGCTCACAGGG + Intronic
906949537 1:50323275-50323297 GAGCAGGGATGGAGCCCAGACGG + Intergenic
907372699 1:54013603-54013625 CAGCATGTGTGGAGCCCTGAGGG - Intronic
908818318 1:68057013-68057035 CAGCTGATGTGGAGCACAGAGGG + Intergenic
909024539 1:70467722-70467744 CAGCTAATATGAAGCCCAGAGGG + Intergenic
909101856 1:71358088-71358110 AATCCTGTGTGGAGCCCAGAAGG - Intergenic
909203510 1:72724941-72724963 CAGCTGATGTGGAGCCCAGCGGG + Intergenic
909467201 1:75985433-75985455 CAACTCGTGTGAAGTCCAGAGGG - Intergenic
909673278 1:78212177-78212199 CAGCTGGGGTGGGGCACTGATGG - Intergenic
910200336 1:84691648-84691670 TAGCTGCTGTTGAGCCCAGGTGG + Intergenic
910333836 1:86105685-86105707 CAGCCAGTGTGGAGCCCAAAGGG - Intronic
910738319 1:90487159-90487181 CAGGTGGTGTGAAGACAAGATGG - Intergenic
910820283 1:91338222-91338244 CACCCTGTGTGGAGCCCAAAGGG + Intronic
912456645 1:109802663-109802685 CAGCTGCCCTGGAGCCCAGTGGG + Intergenic
912643385 1:111368844-111368866 CAGCTGGTGTGGAGGCACAATGG - Intergenic
912887220 1:113488234-113488256 CAGCTGATGTGGATCCCAAAGGG + Intronic
913284937 1:117217591-117217613 CATTTGGGGTGGAGCCAAGATGG + Intergenic
913349500 1:117842307-117842329 CAGCTGAAGTGGAGCCTGGAGGG + Intergenic
915049102 1:153049186-153049208 CAGCTGATGTGGAGCCTAAAGGG + Intergenic
915053447 1:153102799-153102821 CAGCTGATGTGGAGCCTAAAGGG + Intronic
915529160 1:156493549-156493571 CAGATGGAGGGGGGCCCAGAAGG + Intronic
915759394 1:158295502-158295524 CAGCTTCTATGGAACCCAGAGGG + Intergenic
915896488 1:159815237-159815259 CAGCTGGTGTGTAGTCCAGCTGG + Intronic
916420580 1:164634308-164634330 CAGCTGGTGTGGGGCCAGGCAGG - Intronic
917567627 1:176229499-176229521 CCATTGGTGTGGAGCACAGAGGG + Intergenic
917664343 1:177209308-177209330 CAGCTGGTGTGGAGGGCCTAGGG - Intronic
917895595 1:179484258-179484280 CAGCTAGTGTGGAGCCTGGAGGG + Intronic
918089368 1:181275857-181275879 CAGATTGGGTGGAGCCAAGATGG + Intergenic
918126160 1:181585855-181585877 CAGATCATGTGGAGCCCTGAAGG + Intronic
918323051 1:183382997-183383019 CTGCAGGTGTGGAGCCCTCATGG - Intronic
918826844 1:189336086-189336108 CAGCCTATGTGGAGCCCATATGG + Intergenic
919207551 1:194437127-194437149 CAGCTGATGTGGAGCCCAGAGGG + Intergenic
919568565 1:199219025-199219047 CAGCTGACATAGAGCCCAGAGGG - Intergenic
920787004 1:209051310-209051332 CAGCTGATGTGGAGCCCAGAGGG + Intergenic
921193027 1:212726530-212726552 CATTTGCTGTGGAGACCAGAGGG - Intronic
921336597 1:214093101-214093123 AAGCTTGTGTGAAGCCCAGAGGG + Intergenic
921404670 1:214765480-214765502 CAGCTGATGTGGGGCCCAGAGGG - Intergenic
921800813 1:219399916-219399938 CAGCTGATGTAGAGACCAGCGGG - Intergenic
922011912 1:221597279-221597301 CAGCTGGTTCAGAGCCTAGAAGG - Intergenic
922036239 1:221851323-221851345 CAGCTGGTGAGGAGACCTGGGGG + Intergenic
922287271 1:224181327-224181349 CACCTGGAGTGGAGGCCTGAAGG - Intronic
922289455 1:224198419-224198441 CACCTGGAGTGGAGGCCTGAAGG + Intergenic
922679493 1:227579931-227579953 CAGCTGATGCAGAGCCCAAAGGG - Intronic
923273395 1:232377027-232377049 GAGCTGGGGTGGAGACCAGGAGG + Intergenic
923562805 1:235054438-235054460 CAACTGGTGAGGGGCCAAGACGG - Intergenic
923855208 1:237838751-237838773 CAGCTGATGTGGAGCCCAGAGGG + Intergenic
924510270 1:244724205-244724227 CAGCTGCTGTGGAAAACAGAAGG + Intergenic
1063819538 10:9819132-9819154 CAGCTGATGCAGAGCCCAGAGGG + Intergenic
1065985564 10:30948022-30948044 CAGCTGCGGAGGAGCCAAGATGG - Intronic
1066025347 10:31352627-31352649 CTGCTGGCGTGGAGCACAGTTGG + Intronic
1068050892 10:51947598-51947620 CAGCAGGAGGGGAGCCAAGATGG - Intronic
1068314113 10:55319804-55319826 CAGATGGTGCAGAGTCCAGAGGG + Intronic
1068463030 10:57351531-57351553 CAGCTCATGTAGAGCCAAGAGGG - Intergenic
1069240184 10:66129426-66129448 CAGCCAGGGTGGAGCCCAGAGGG + Intronic
1069302482 10:66926110-66926132 GAGCTGCGTTGGAGCCCAGAAGG - Exonic
1069806071 10:71125807-71125829 CAGCTGATATGGAGCCCAGGGGG - Intergenic
1069845086 10:71365444-71365466 CAGTTAGTGTGGAGCACAGGGGG + Intergenic
1070300192 10:75198031-75198053 AAGCTGATGAGGAGGCCAGAGGG - Intergenic
1070770772 10:79081119-79081141 CACATCGTATGGAGCCCAGAAGG + Intronic
1070843434 10:79503719-79503741 CAGCGGCTGTGGAGCCCTTAAGG - Intergenic
1071021911 10:81067297-81067319 GAGCTGGTGGTGAGGCCAGATGG + Intergenic
1071736143 10:88303226-88303248 CAGCTGATGTGGAGCCCAGATGG + Intronic
1072026722 10:91467287-91467309 CAGCCTGTGTGGCGCCCAGATGG + Intronic
1072227274 10:93382344-93382366 CAGCTAGTTGGGAGGCCAGAGGG - Intronic
1072617703 10:97060417-97060439 CAGCTGGGTGGGACCCCAGAGGG + Intronic
1072743795 10:97926160-97926182 CTGTTTCTGTGGAGCCCAGAAGG + Intronic
1076574281 10:131453601-131453623 CAGCTGGTTCAGAGGCCAGAGGG - Intergenic
1076774326 10:132686027-132686049 CAGTTGGTGTGGAAGCCTGATGG + Intronic
1077444818 11:2586063-2586085 CAGCCGCTGAGGTGCCCAGAGGG + Intronic
1077841718 11:5982704-5982726 CAGTCTATGTGGAGCCCAGAGGG - Intergenic
1078694858 11:13620774-13620796 CAGCCTGTGTGGGGCCTAGAGGG - Intergenic
1079668295 11:23135000-23135022 CAGCTGATGTGGAGCCCAGAGGG - Intergenic
1080224921 11:29949867-29949889 CAGCTGATGTGGAGCACAGAGGG + Intergenic
1082003012 11:47404101-47404123 CAGTTGGTTTGGAGGCCATAGGG - Intergenic
1082665443 11:55970842-55970864 CAGCCTGTGTGGAATCCAGAGGG + Intergenic
1082956691 11:58877404-58877426 CAGAGGGAGTGGAGCCAAGATGG - Intronic
1083215853 11:61219312-61219334 CAGCTTGTCTGGGGCCCACATGG - Intergenic
1083359717 11:62097918-62097940 CAGTTGCTGTGAAGCACAGAAGG - Intergenic
1084483029 11:69432972-69432994 CACCTGGTGTGGAACCCAGCAGG + Intergenic
1084486190 11:69449688-69449710 CAGCAGGTGTGCATCCCAGGGGG + Intergenic
1084662866 11:70557462-70557484 CAGTGGGGGAGGAGCCCAGATGG + Intronic
1084825064 11:71723724-71723746 TAGCGGGGGTGGAGCCAAGATGG + Intergenic
1084864012 11:72041216-72041238 CAGTGGGGGTGGGGCCCAGAGGG + Intronic
1085022259 11:73217286-73217308 CAGCTGATATGGAGCCCAAGAGG + Intergenic
1085405787 11:76261059-76261081 CAGCAGGTGTGGAACCACGAGGG + Intergenic
1085455384 11:76662491-76662513 CAGCTGGTGAGGAGCAGAGCTGG + Intronic
1085797135 11:79552649-79552671 TAGCTGGGGAGGAGCCAAGATGG + Intergenic
1085815040 11:79728199-79728221 TAGCTGATGTGGAGCCTAGAGGG - Intergenic
1085856530 11:80181852-80181874 CCGCTGATGTGGAGCCCACAGGG - Intergenic
1086462854 11:87022855-87022877 CAGCTGATGTGGAGCCCAGAGGG + Intergenic
1087337558 11:96863697-96863719 CAGCTGATATGGAGCCCAGAGGG - Intergenic
1087597534 11:100272906-100272928 CAGCTGATGTGGAGCCCAGAGGG + Intronic
1087619828 11:100528644-100528666 CAGCTGATGTGGAGCCCAGAGGG + Intergenic
1087780009 11:102291706-102291728 CAGCAAGTGTGGAGCCCTGGAGG - Intergenic
1087868930 11:103267004-103267026 CAGCTGATGTGGAGCCCAGGGGG - Intronic
1087946835 11:104172295-104172317 CCCTTGGTGTGGAGCCCAGTTGG + Intergenic
1088806622 11:113358679-113358701 CAGTTGATGTGGAGCCCAGAGGG - Intronic
1089071158 11:115700684-115700706 CAGAGGGTGGGGAGACCAGAGGG + Intergenic
1089305548 11:117524172-117524194 GAGCTGGTGTGGAGAGCAGGTGG - Intronic
1090684434 11:129100122-129100144 CAGTTGATGTGGAGCCCAGAAGG + Intronic
1091529499 12:1340399-1340421 CAGCTGAGGTGGAACCCAGAGGG - Intronic
1091848647 12:3677727-3677749 CAGCAGGTGTCGACCACAGAAGG - Intronic
1091850591 12:3693868-3693890 CAGCTGATGCAGAGCCCAGAGGG - Intronic
1092418040 12:8307164-8307186 TAGCGGGGGTGGAGCCAAGATGG - Intergenic
1093038045 12:14351714-14351736 CAGCAGGGGTGGAGCCCTCATGG - Intergenic
1093102008 12:15038671-15038693 CAGCTTGTGCAGAGCTCAGAGGG - Intergenic
1093496447 12:19763295-19763317 CAGCCTTTGTGGAGCCCAGAAGG + Intergenic
1095542807 12:43330314-43330336 CAGCTGATGTGGAGCCCAGAGGG - Intergenic
1098590141 12:72201499-72201521 CAGAGGGTCTGGAGCCTAGAGGG - Intronic
1098678498 12:73321264-73321286 CAGCTGATGTGGAGCCCAGAGGG + Intergenic
1099732802 12:86526457-86526479 CAGCTGGTGTGTGGCCATGAGGG + Intronic
1100266136 12:92978336-92978358 TAGCTTGTGTGGAGTCCAGAGGG + Intergenic
1100817692 12:98401631-98401653 CAGCTGGAGAGGAGCCAAGCAGG + Intergenic
1102668960 12:114601042-114601064 CTGCAGGGGTGGAGCCCACATGG + Intergenic
1103008619 12:117440590-117440612 CAGCTGCTGTGAACCCCAAATGG + Intronic
1103153643 12:118664012-118664034 CATGGGGTGTGGAGCCAAGATGG - Intergenic
1105277937 13:18947113-18947135 CAGTGGGTGTGGAGCAGAGAGGG + Intergenic
1105396857 13:20044191-20044213 CAGCTGATCTGGAGCCCACAGGG - Intronic
1105617375 13:22030871-22030893 CGGCTGCTGAGGAGCCCACAGGG - Intergenic
1106243562 13:27928378-27928400 AGGCTTGGGTGGAGCCCAGAGGG - Intergenic
1106348037 13:28898603-28898625 CAGCTAGTGTGGCACTCAGATGG - Intronic
1106588334 13:31076363-31076385 CAGATGGTGTGGAGGGGAGATGG + Intergenic
1108453425 13:50589248-50589270 CAGCTGGGGTGGAACCCTGCAGG + Intronic
1108775552 13:53761285-53761307 CAGTGGGTGGGGAGCCTAGAGGG + Intergenic
1109309166 13:60672067-60672089 CCCCTGGTGTGGAGCAGAGAGGG + Intergenic
1109326206 13:60870378-60870400 CAGCTGATATGGAGCCCAGAGGG - Intergenic
1109667133 13:65553746-65553768 CAGCTGATGTGGAGCCCAGAGGG - Intergenic
1109718371 13:66246199-66246221 CTGCAGGAGTGGAGCACAGATGG + Intergenic
1109910582 13:68905679-68905701 CTGCTGGAGTGGAGCCCTCATGG + Intergenic
1110162305 13:72393114-72393136 CAGCTGTGGTGGAGCAGAGATGG - Intergenic
1111113711 13:83749450-83749472 CAGCTGATGCGGAGCCCAGAGGG + Intergenic
1111526415 13:89476665-89476687 CAGCTGATGTGAAGCCCAGAAGG - Intergenic
1112422754 13:99268022-99268044 CAGCTGGTGTGGAAGAAAGAAGG + Intronic
1113360171 13:109623235-109623257 CAAATGGTGTGGGCCCCAGATGG + Intergenic
1113669462 13:112165821-112165843 CAGCTGATGTGAAGCCCAGTGGG + Intergenic
1114059059 14:19002290-19002312 CAGGTGATGTGGAGCCCAGAGGG + Intergenic
1114103484 14:19399464-19399486 CAGGTGATGTGGAGCCCAGAGGG - Intergenic
1114134645 14:19834223-19834245 TAGCCGATATGGAGCCCAGAGGG + Intergenic
1114425834 14:22621746-22621768 CACTTGGGGTGGAGCCAAGATGG - Intergenic
1114936783 14:27548798-27548820 CTGCAGGTGTGGAGCCCTCATGG + Intergenic
1115601031 14:34956169-34956191 CACCTGATGTGGAGACCAGAGGG + Intergenic
1115869014 14:37778989-37779011 CAGCTTGTGCAAAGCCCAGAGGG - Intronic
1115883373 14:37945421-37945443 CAACTGATGTGGAGCCCAGATGG + Intronic
1116243483 14:42378771-42378793 CAGCTGATGTGTAGCCCAGAAGG + Intergenic
1116649095 14:47566521-47566543 CAGCATGTGTGCAGCCCAGAGGG - Intronic
1117638668 14:57774420-57774442 CAACTGGTGCAGAGTCCAGAGGG + Intronic
1118478488 14:66141177-66141199 CAGCTGATGTGAAGCCCAGAGGG + Intergenic
1118540042 14:66813625-66813647 CAGCTGATGTGGAGCCCAGAGGG + Intronic
1118740638 14:68737082-68737104 CAGCTGGGGTGGGCTCCAGAGGG - Intergenic
1119264350 14:73255186-73255208 CACCTGGTGTGCAGCCCACCAGG + Intronic
1119436683 14:74601992-74602014 GAGCTGATGTGGACCCAAGAGGG + Intronic
1120688254 14:87563691-87563713 CAGCAGGTGTGGGGCCCTCATGG + Intergenic
1120723964 14:87916991-87917013 CAGCCAGTGAAGAGCCCAGAGGG - Intronic
1120833904 14:89023262-89023284 CATGTGGTGTGGACCCCTGATGG + Intergenic
1121714941 14:96067122-96067144 CAGGTGCTGGGGTGCCCAGAAGG + Intronic
1123496752 15:20834341-20834363 CAGCTGATGTGGAGCCCGGAGGG - Intergenic
1123553986 15:21407933-21407955 CAGCTGATGTGGAGCCTGGAGGG - Intergenic
1123577698 15:21689797-21689819 TAGCCGATATGGAGCCCAGAGGG + Intergenic
1123590231 15:21845298-21845320 CAGCTGATGTGGAGCCCGGAGGG - Intergenic
1123614322 15:22132278-22132300 TAGCCGATATGGAGCCCAGAGGG + Intergenic
1123721241 15:23063757-23063779 CAGCCTGTGCAGAGCCCAGAGGG + Intergenic
1123875778 15:24622333-24622355 CAGCCTGTGTAGAGCCCAGAGGG - Intergenic
1124187128 15:27541125-27541147 AGGCTTGTGTGGACCCCAGAGGG - Exonic
1125184458 15:36914616-36914638 AAGCTGAAGTGGAGCCGAGAGGG + Intronic
1125367403 15:38932669-38932691 CAGCTCATGTGGAACCCAGAGGG - Intergenic
1125755387 15:42060722-42060744 CAGCTTGTTTGGAGCCAAGGGGG - Intergenic
1126225157 15:46261821-46261843 CAGCTGATGTGCAGATCAGAGGG - Intergenic
1126227711 15:46290216-46290238 CAGCCTGTGCAGAGCCCAGAGGG - Intergenic
1126506263 15:49407160-49407182 CAGCTGATGTGGAGCCCAGAGGG - Intronic
1126883385 15:53123210-53123232 CAGCTGGTGTGGAACAGAGGTGG - Intergenic
1127098214 15:55535050-55535072 CTGCTGAAGAGGAGCCCAGAGGG + Intergenic
1127854231 15:62941548-62941570 CAGGTGCTGTGGGGTCCAGAGGG - Intergenic
1128842811 15:70863942-70863964 CAGCTGATGAGCAGCACAGAAGG - Intronic
1129267838 15:74403540-74403562 CACCTTGTGTAGAGCCCAGAAGG - Intergenic
1129332814 15:74836515-74836537 TGGCTAGTGTGGGGCCCAGAGGG + Exonic
1129572242 15:76700304-76700326 CAGCTTGTGAAGAGTCCAGAGGG - Intronic
1129753639 15:78083047-78083069 TAGATGGAGTGGAGCCCTGAGGG - Intronic
1129931076 15:79411776-79411798 CAGCCTGGGTGGAGCCCAGAGGG + Intronic
1130175045 15:81559580-81559602 CAGCCTGCATGGAGCCCAGAGGG - Intergenic
1132244725 15:100285757-100285779 CAGCCTGTGTGGAGCCCAGAGGG + Intronic
1202962334 15_KI270727v1_random:135129-135151 CAGCTGATGTGGAGCCCGGAGGG - Intergenic
1202986567 15_KI270727v1_random:424042-424064 TAGCCGATATGGAGCCCAGAGGG + Intergenic
1132858930 16:2060509-2060531 CAGCAGGTGGGGCGCCCAGGAGG - Intronic
1132891339 16:2206273-2206295 CAGCCTGTGTGAAGGCCAGATGG + Intronic
1134502410 16:14779611-14779633 GGGCTGGTGTGGAAGCCAGAGGG + Intronic
1134578154 16:15349283-15349305 GGGCTGGTGTGGAAGCCAGAGGG - Intergenic
1134651316 16:15911151-15911173 AGGCTGAGGTGGAGCCCAGAAGG + Intergenic
1134724437 16:16408263-16408285 GGGCTGGTGTGGAAGCCAGAGGG + Intergenic
1134942994 16:18303596-18303618 GGGCTGGTGTGGAAGCCAGAGGG - Intergenic
1135800476 16:25489384-25489406 TAGCCTGTGTGGAGCCCAGAGGG - Intergenic
1137486330 16:48894495-48894517 CAGCTGCTGTGCAACCCACATGG - Intergenic
1137518881 16:49174705-49174727 CAGCTGGGATGGAGACCAAATGG - Intergenic
1137715285 16:50594773-50594795 CTGCTGGTGGGGAGCACATAGGG + Intronic
1138625811 16:58250322-58250344 CCGGTGGTGAGAAGCCCAGAGGG + Intronic
1139463889 16:67143500-67143522 CACCTAGCGTGGTGCCCAGATGG - Intronic
1141182800 16:81765857-81765879 CAGCTGCTGTGTAGCCAAGGTGG + Intronic
1141592440 16:85077679-85077701 AGGCTGGTGTGGAGCTCGGACGG + Intronic
1141662014 16:85446570-85446592 CAGCAGGAGTGGAGAGCAGAGGG + Intergenic
1142212967 16:88817085-88817107 CAGCTGATGTGGGTCCCAGCAGG - Intronic
1142877755 17:2862357-2862379 GAGCTTGTGTGGTGCACAGATGG + Intronic
1143038463 17:4015096-4015118 CAGCTGGTGTGGAGCAAGGCTGG + Intronic
1143217103 17:5233302-5233324 CAGCCAGTGGGGAGCCCAGTGGG - Intronic
1143769802 17:9161407-9161429 CAGCTTATTTGGAGCCCTGAAGG + Intronic
1143960424 17:10712875-10712897 CAGATAGTGTGGAGCCCTTAGGG + Intronic
1147600191 17:41740392-41740414 CAGGTGGTGGCGAGCCTAGAAGG + Intergenic
1149180570 17:53931739-53931761 CAGCAGGTGGGGAAGCCAGACGG + Intergenic
1149457690 17:56801635-56801657 CAGCTGGGGTAGAGGGCAGATGG + Intronic
1149547062 17:57511494-57511516 CAGCAGGACTTGAGCCCAGATGG - Intronic
1150274801 17:63889758-63889780 CAGCTGCTGTGGATCTCTGAGGG + Intergenic
1151141102 17:71993011-71993033 CAGCCTGTGCAGAGCCCAGAGGG + Intergenic
1151359040 17:73577477-73577499 CAGCTGGTGTGGAGAGTGGAGGG + Intronic
1151487700 17:74411766-74411788 CAGCTAGAGTGAGGCCCAGAGGG + Intergenic
1151532183 17:74713637-74713659 CAGATGCTTGGGAGCCCAGAAGG + Intronic
1152215563 17:79029799-79029821 CAGGTGGTAGGGAGCCCAGCAGG - Intronic
1153399345 18:4666533-4666555 CAGCTGGTGTGAAGCCCAAAGGG + Intergenic
1153595510 18:6721189-6721211 CAGGTGGTGCAGAGCCCAGGAGG + Intergenic
1153816590 18:8795731-8795753 CAGCTGGTGGAGAGCACAGCAGG - Intronic
1154454659 18:14510025-14510047 CAGCTGATGTGGAGCCTGGAGGG - Intronic
1155774225 18:29738119-29738141 TAGCCTGTGTGGAGCCCAGAGGG - Intergenic
1155845131 18:30695842-30695864 CAGCCAGTGTGAAGCCCAAAGGG - Intergenic
1156076193 18:33282286-33282308 CAGCTGATGTGGAGCCCAGAGGG + Intronic
1156419302 18:36933651-36933673 CAGCTGGTGCCCAACCCAGAGGG - Intronic
1156448233 18:37252504-37252526 CACCTGGTGTGGGGCCTTGAAGG - Intronic
1156707908 18:39905805-39905827 CAGCTAGTGTGAAGACCAGCAGG - Intergenic
1158965859 18:62621725-62621747 CAGCTGGGGACGAGGCCAGAAGG + Intergenic
1159022556 18:63155498-63155520 CTGCTGGGGTGGAGGCCACAGGG + Intronic
1160130181 18:76218444-76218466 CTGCTGGTGGGGAGCCCAGTAGG + Intergenic
1160704332 19:522920-522942 CAGCTGGTGCCCAGTCCAGAGGG - Intergenic
1160965112 19:1744046-1744068 CAGCTGGTGTGGGGCCGGGCTGG - Intergenic
1161276574 19:3421510-3421532 CGGCTGCTGTCCAGCCCAGATGG + Intronic
1163690527 19:18736068-18736090 CTGCTGGCGTGAAGCCCAGCTGG - Intronic
1164812497 19:31168799-31168821 CAGCTGGTCTTGAGCCCCGTAGG + Intergenic
1165857137 19:38886184-38886206 TTGCTGGTAGGGAGCCCAGAAGG - Intronic
1166087675 19:40487843-40487865 CAGCTGGTGAGGGGGCCTGAAGG + Exonic
1166299449 19:41905819-41905841 CAGCTGATGGTGAGACCAGAGGG + Exonic
1166391647 19:42411879-42411901 TAGGTGGTGTGGGTCCCAGAGGG - Intronic
1166534145 19:43561479-43561501 CAGCTAGTGTGCAGCACAGCTGG - Intronic
1202636317 1_KI270706v1_random:47535-47557 CAGGTGATGTGGAGCCCAGAGGG - Intergenic
925036995 2:695262-695284 GAGCTGGCATGGAGCCCAGTGGG - Intergenic
925107597 2:1306331-1306353 CAGATGGTGGGGGGCCCAAAAGG - Intronic
925146033 2:1584183-1584205 CAGCTGGTATGGAGCCCGCAGGG - Intergenic
926747664 2:16172556-16172578 CAGGTGGTGTGGACACAAGATGG + Intergenic
928428934 2:31202039-31202061 CAGATGGTGATCAGCCCAGAAGG + Intronic
929277703 2:40043638-40043660 CTCCTTGTGTGAAGCCCAGAAGG + Intergenic
929381942 2:41364461-41364483 TAGCTGATATGAAGCCCAGAGGG + Intergenic
930007491 2:46909733-46909755 CAGCTGGGCTGCAGCCTAGAGGG + Intronic
930028706 2:47045325-47045347 GAGCTGGGGTGGAGCCCTGGAGG - Intronic
930064750 2:47319343-47319365 CAGCCAGTGAGGAGCCCAGCTGG + Intergenic
930930300 2:56874579-56874601 CAGCTGTTGTGGAGCCCAGAGGG + Intergenic
931139933 2:59446240-59446262 TAGCTGGTGGGGAGCCTGGAAGG + Intergenic
931489270 2:62726176-62726198 CAGCTGATGTGGAGCTCAGAGGG - Intronic
931557154 2:63518534-63518556 AAGCCAGTGGGGAGCCCAGAGGG + Intronic
931815794 2:65899265-65899287 CAGCTGCTGAGGCTCCCAGAGGG - Intergenic
932539613 2:72638734-72638756 CAGCTCATGTGGAGCCTAGAGGG + Intronic
933207743 2:79528323-79528345 CAGCTACTGTGGAGACCAAAGGG - Intronic
933555335 2:83823929-83823951 CAGCTGATGTGAAGCCTAGATGG - Intergenic
933613827 2:84463478-84463500 CAGGTGGTGGGGAGACTAGAAGG - Intergenic
934099614 2:88640733-88640755 CAGCTGATGTGGAGCCCAGAGGG + Intergenic
934646290 2:96061133-96061155 GAGCAGCTGTGTAGCCCAGACGG - Intergenic
934839693 2:97617215-97617237 GAGCAGCTGTGTAGCCCAGACGG - Intergenic
934936425 2:98469167-98469189 CAGCTGGGGTGGAGAGCAGTGGG + Intronic
935449171 2:103189761-103189783 CAGCTGATGTGGAGCCCAAAAGG + Intergenic
935711384 2:105902136-105902158 CAACTGATGCAGAGCCCAGAGGG - Intergenic
935847944 2:107187310-107187332 CAGCTGATTAGGAGCCCAGAGGG + Intergenic
935858391 2:107299952-107299974 TAGAGGGTGTGGAGCCAAGATGG - Intergenic
935888301 2:107648502-107648524 CAGCTGATGTGGAGCCCAGAAGG + Intergenic
936956112 2:118023954-118023976 CAGCTGTTGGACAGCCCAGAGGG - Intergenic
937195857 2:120156030-120156052 CAGCTGATGTGGAGCCCAGAGGG + Intronic
937569105 2:123334358-123334380 TAGTTGATGTGGAGCCCAGAGGG + Intergenic
937794591 2:126001889-126001911 CTGCTGGTGTGAAGGCCAAAGGG - Intergenic
937841120 2:126525673-126525695 CTTCTGGTGAGGAGCTCAGAAGG + Intergenic
938477530 2:131629549-131629571 CAGGTGATGTGGAGCCCAGAGGG + Intergenic
939016529 2:136910230-136910252 AAGCAGGAGTGGAGCCAAGAGGG + Intronic
939199768 2:139018779-139018801 CAGCTGATGTGAAGCCCAGAGGG - Intergenic
939807159 2:146788397-146788419 TAGCTGTGGTGGAGCCAAGATGG + Intergenic
940405757 2:153300027-153300049 CAGCTGTTCTAGAGCTCAGAAGG + Intergenic
940436815 2:153665870-153665892 CAGGCAGTGTGGAGCCCAGAGGG + Intergenic
943090610 2:183370129-183370151 CAGCTTGTGGGAGGCCCAGAGGG + Intergenic
943092438 2:183390568-183390590 CAGCTGATATGGAGCCCAGATGG - Intergenic
943093862 2:183405173-183405195 CAGCCAGTGTGGAGCCGAGAAGG - Intergenic
943153125 2:184138781-184138803 CAGCTGGTGTGGAGCCCAGAGGG - Intergenic
943489591 2:188534047-188534069 CAGCTGCTGTGGAGAGCAGTTGG + Intronic
944353486 2:198758020-198758042 GAAATGGTATGGAGCCCAGATGG - Intergenic
944621719 2:201522707-201522729 CAACCTGTGTGGAGCCCAGAGGG + Intronic
947010065 2:225555802-225555824 GAGCTGGTGAGGAACACAGATGG + Intronic
948131774 2:235606276-235606298 CTGCTGTTGTGGAGAACAGAAGG - Intronic
948237758 2:236403197-236403219 CAGCATGTGTGAAGTCCAGATGG + Intronic
948332063 2:237177559-237177581 AAGCTGTTGTTGAGCCCAGTGGG + Intergenic
948630246 2:239297726-239297748 CAGGTGGGGCTGAGCCCAGAGGG - Intronic
1169425400 20:5492963-5492985 CTGCTGCTGTGGAGCCCCAAAGG - Intergenic
1169956925 20:11114012-11114034 CAGATGGGGTGGAGCAAAGAAGG - Intergenic
1170669219 20:18415323-18415345 CGGCTGGTGTGGAGCCATGGTGG - Exonic
1170988990 20:21285005-21285027 GAGCTAGTGTGGAAACCAGAAGG - Intergenic
1170991679 20:21307110-21307132 GAGCTAGTGTGGAAACCAGAAGG + Intronic
1171046111 20:21810273-21810295 CTGCTGGGGTGCAGCCCAGATGG - Intergenic
1171053515 20:21883568-21883590 CAGCTGATATGGAGCCCAGAGGG - Intergenic
1171936591 20:31280085-31280107 CAGCCGGTGTGGAGCCCAGAGGG + Intergenic
1172056427 20:32157698-32157720 CTCCTTCTGTGGAGCCCAGAAGG + Intronic
1172211318 20:33200445-33200467 CAGATTGTGTGGAGCCTTGAGGG - Intergenic
1172445477 20:34991016-34991038 CAGCTGGTGTAGCACCAAGAAGG - Exonic
1173552536 20:43942930-43942952 CTTCTGGTGTGGAGACAAGAAGG - Intronic
1173556475 20:43969690-43969712 CAGCTGGTTCTGAGCCCAGCAGG + Intronic
1174126656 20:48311585-48311607 CAGCCGATGGGGAGGCCAGAAGG + Intergenic
1174406982 20:50309056-50309078 TAGCTGGTCAGGGGCCCAGAGGG - Intergenic
1175222511 20:57425535-57425557 CAGCTGGGGAGGGGCCCAGATGG + Intergenic
1176264734 20:64203236-64203258 CAGCTGCTGTGGAGGCCTGTGGG - Intronic
1176804124 21:13463720-13463742 GAACTGGTGTGGATCCCAGGGGG + Intergenic
1176819507 21:13643283-13643305 CAGCTGATGTGGAGCCCGGAGGG + Intergenic
1177132075 21:17271302-17271324 CAACAGGGGTGGAGCCAAGATGG + Intergenic
1177356906 21:20019995-20020017 CAGCTGATATGGAGCCTTGAGGG - Intergenic
1177816705 21:25985974-25985996 CAGCTGGTGAGGATCCCGGAAGG + Intronic
1178736142 21:35153766-35153788 CAGCAGGTCTGGAGCACAGCTGG + Intronic
1180016977 21:45093471-45093493 CAGCAGCTGTGTGGCCCAGAGGG - Intronic
1180364549 22:11926781-11926803 CAGGTGATGTGGAGCCCAGAGGG + Intergenic
1180477543 22:15724906-15724928 CAGGTGATGTGGAGCCCAGAGGG + Intergenic
1180998562 22:19977421-19977443 CAGCTGCTTTGGAGGCAAGAAGG - Exonic
1181123759 22:20690067-20690089 CGGCTGTTGTGGACCCCAAAGGG - Intergenic
1181209791 22:21282917-21282939 CGGCTGTTGTGGACCCCAAAGGG - Intergenic
1181727640 22:24822575-24822597 GAGCTGATGTGGAGCAGAGAGGG + Intronic
1184330803 22:43826255-43826277 CACCTGGTCTGTAGCTCAGACGG - Intronic
1184456104 22:44610131-44610153 CAGCTGGTGCGGAGGCAGGAGGG + Intergenic
1184523619 22:45009314-45009336 CAGGCGGAGGGGAGCCCAGAAGG + Intronic
1185208033 22:49551439-49551461 CAGCTGGGCTGGTGCGCAGAAGG + Intronic
1185278437 22:49959933-49959955 CAGCTGCTGGAGAGCCCGGAGGG + Intergenic
949759949 3:7459339-7459361 CAGCAGGTGGGGAGCAGAGAGGG + Intronic
949867807 3:8560741-8560763 CAGCTGGCTTGGAGCCCATCAGG - Intronic
950589323 3:13924930-13924952 CTGCAGGGGTGGAGCCCACATGG + Intergenic
950923158 3:16715685-16715707 CAGCTGATGTGGAGCACAGGTGG - Intergenic
951180669 3:19654833-19654855 CTGCAGGGGTGGAGCCCACATGG - Intergenic
951258750 3:20482008-20482030 CAGCCAATGTGGAGCCCAGAGGG + Intergenic
951822367 3:26827141-26827163 CAGCTGATGAGCAGCCCAGAGGG + Intergenic
952669900 3:35953799-35953821 CAGCCTGTGCAGAGCCCAGAAGG - Intergenic
953104218 3:39860342-39860364 CAGCTTGTACAGAGCCCAGAGGG + Intronic
953448582 3:42988137-42988159 CAGCTGGGCTGGAGGCCAGAAGG - Intronic
954373759 3:50183722-50183744 AAGCTGTGGAGGAGCCCAGATGG + Intronic
954522706 3:51243232-51243254 CAGATGATGTGGAGCCCAGGGGG - Intronic
954583504 3:51716259-51716281 CAGCTTGTGTGGATCCCAAGGGG + Intronic
955937200 3:64113181-64113203 CAGCTGATGTGTAGCCCAGAGGG + Intronic
956371710 3:68570651-68570673 CAGCCAGAGTGGAGCCCAGAGGG + Intergenic
956378868 3:68644898-68644920 TAGCCTGTGTGGAGCCCAGAGGG - Intergenic
957867030 3:86039078-86039100 CAGAGGGGGTGGAGCCAAGATGG + Intronic
958064792 3:88529175-88529197 CAGCCTGTGTGGAGCCCAGAGGG - Intergenic
958154097 3:89730770-89730792 CTGCAGGGGTGGAGCCCACATGG + Intergenic
958460032 3:94383172-94383194 CAGCCTGCATGGAGCCCAGAGGG + Intergenic
958464589 3:94442520-94442542 CTACTGATGTGGAGCCCAGAGGG + Intergenic
958609783 3:96410395-96410417 CTGCTGGGGTGGAGCCCACATGG - Intergenic
958768767 3:98402015-98402037 CAGCTGAGGTGAAGCCCAGAGGG + Intergenic
959041062 3:101423937-101423959 CAGCTGATGTGGAGCCCAGAAGG + Intronic
959169728 3:102830374-102830396 CAGTTGATATGGAGCCCAGAGGG + Intergenic
959228658 3:103619030-103619052 CTGCAGGTGTGGAGCCCTCATGG - Intergenic
959421520 3:106135363-106135385 CAGCTGATGTGGAGCCCAGAGGG + Intergenic
959433551 3:106284816-106284838 TAGCCAGTGTGGAACCCAGAGGG + Intergenic
959496818 3:107061320-107061342 CAGCTGGTGTTAAGGCAAGAAGG - Intergenic
959674683 3:109021040-109021062 CAGGTGGGCTGGTGCCCAGAGGG + Intronic
960015713 3:112885461-112885483 CAGCCTGTGTGAAGCCCAGAGGG - Intergenic
960736279 3:120784621-120784643 CAGGTGGTGTAGAGGACAGATGG - Intergenic
961027149 3:123568352-123568374 CCGCTGCTGTGGCTCCCAGATGG - Intronic
961694998 3:128698431-128698453 GAGCGGGTGAGGAGCCCAGCGGG - Intergenic
961895740 3:130166542-130166564 TAGCGGGGGTGGAGCCAAGATGG - Intergenic
961987972 3:131157922-131157944 CAGCTGATGTGAAGTCCAGAGGG + Intronic
962335693 3:134527980-134528002 CAGCTGATATGGAGCCCAGAGGG - Intronic
962655813 3:137542911-137542933 CAGCCTATGTGGAGCCCAGAGGG - Intergenic
962836820 3:139196748-139196770 CAGCCGAGGTGGAGCCAAGACGG - Intronic
962981946 3:140498480-140498502 CAGATGGTGCCGAGCTCAGAGGG + Intronic
963401273 3:144802504-144802526 CAGCCTGTGTGGACCCCAGAGGG - Intergenic
963914185 3:150842406-150842428 CAGCTGATGTGGAGACTAGAGGG - Intergenic
963942682 3:151110858-151110880 CTGCTGCTGTTGAGCCAAGATGG + Intronic
964142556 3:153420243-153420265 CAGTCTGTGTGGAGCCCAGAAGG - Intergenic
964296590 3:155240316-155240338 CAGCCGGTATGGAGCTCAGAGGG - Intergenic
964391495 3:156202155-156202177 CAGCCAGTGTTGAGCCTAGAGGG - Intronic
964508202 3:157422182-157422204 CAGCTAGTGTGAGGCCCAGATGG + Intronic
964630155 3:158801762-158801784 AGTCTGGTGTGGAGCCGAGAGGG + Intronic
965147818 3:164928549-164928571 CAGTCTGTGTGGACCCCAGAGGG - Intergenic
966219040 3:177532665-177532687 GAGCTTGTGGTGAGCCCAGATGG - Intergenic
966320898 3:178699792-178699814 CAGCTGATGTGAAGCCCAGAGGG - Intronic
966649091 3:182279136-182279158 CAGCTGGTGAAGAGAGCAGAAGG - Intergenic
966714358 3:183000697-183000719 CAGCTGATGTGGAGCCCAAAAGG - Intergenic
966830733 3:184006132-184006154 CGATTGGTGTGGAGCCCAGGTGG - Intronic
967523646 3:190466522-190466544 CAGCTGATATGGAGCCCAGAGGG + Intergenic
967888248 3:194347456-194347478 CAGCTGAGCTGGAGCCCAAATGG - Intronic
967941385 3:194769100-194769122 CAGCAGGTGGGAAGTCCAGAAGG - Intergenic
968490845 4:889856-889878 CAGCTGGTGAGGAGTGGAGAGGG - Intronic
968708009 4:2092377-2092399 CAGCTGCTGCTGAGCCCAGCAGG - Intronic
969589871 4:8115610-8115632 CAGCCCGTGGGGAGCTCAGAGGG - Intronic
969836991 4:9850312-9850334 CAGCCTGTGTGTTGCCCAGAGGG + Intronic
970061533 4:12039483-12039505 CTGCTGGGGTGGAGCCCTCATGG + Intergenic
970101131 4:12524115-12524137 CAGCTGATTTGGACCCCAGAGGG + Intergenic
970703483 4:18771115-18771137 CAGTCTGTGTGGAGCCCAGAAGG + Intergenic
970768716 4:19584094-19584116 CTCCTTGGGTGGAGCCCAGAAGG - Intergenic
971598801 4:28567341-28567363 CAGCCTGTGTGGAGCCCAGATGG + Intergenic
972830636 4:42810129-42810151 CAGCTGATGTGGAGCCCAGAGGG - Intergenic
972835289 4:42862937-42862959 CAGATGCTGTGGAGCCCAGCAGG + Intergenic
972883728 4:43458529-43458551 CACCTTGTGTGAAGCCCAGTGGG - Intergenic
973034681 4:45391036-45391058 CAGCCTGCATGGAGCCCAGAGGG - Intergenic
973366116 4:49210906-49210928 CAGGTGATGTGGAGCCCAGAGGG - Intergenic
973394481 4:49581530-49581552 CAGGTGATGTGGAGCCCAGAGGG + Intergenic
973607212 4:52599837-52599859 CAGATGGGCTGGAGCTCAGAGGG - Intronic
974199927 4:58623953-58623975 CAGCTGGTATGAAGCCCAGAAGG + Intergenic
974628463 4:64453603-64453625 CTGCAGGTGTGGAGCCCTCAGGG - Intergenic
975022182 4:69503025-69503047 CAGCTGATGTGAAGCCAAGAGGG + Intronic
975361672 4:73477605-73477627 CAGCTGATGTGTAGGCCAAAGGG - Intergenic
975403670 4:73965545-73965567 CAGCTGATGTGGAGCCCAGAAGG - Intergenic
975897224 4:79107095-79107117 CAGCCAGTGCAGAGCCCAGAGGG - Intergenic
978054755 4:104249504-104249526 CAGCTTGTGCAGACCCCAGAGGG - Intergenic
978231787 4:106408576-106408598 CATTTGGGGTGGAGCCAAGATGG - Intergenic
979010080 4:115355778-115355800 CAGCTGATGTGCAGCCCAGGAGG - Intergenic
979156691 4:117401372-117401394 CAGGAAGTGTGAAGCCCAGACGG + Intergenic
979158651 4:117429970-117429992 CAGCTGATGTGGATCCCAGAGGG - Intergenic
979995059 4:127421966-127421988 CAGCTGGTGGATAGCCCTGAAGG - Intergenic
980148261 4:129015609-129015631 CAGCTCATGTGGATCCCAGAGGG - Intronic
980257753 4:130403573-130403595 CAGCTGATGTGGAGCCCAGAGGG - Intergenic
980791888 4:137631623-137631645 CAGCCTGTGTGAAGCCCAGAGGG + Intergenic
981407718 4:144391550-144391572 AAGCTGGGCTGGAGCCAAGATGG + Intergenic
981454132 4:144933839-144933861 TAGTTGATGTGGAGCCCAGAGGG - Intergenic
981466231 4:145075798-145075820 CAGCCTGTGTGGAGCCCAGAGGG + Intronic
981511800 4:145566091-145566113 CAGCTGGTGCAGAGCCCAGAGGG + Intergenic
981645303 4:146991797-146991819 CAGCCAGTGTGGAATCCAGAGGG - Intergenic
981849978 4:149218680-149218702 CAGCTGACATGGAGCCCAGAGGG + Intergenic
982629875 4:157819184-157819206 CAACAGATGTCGAGCCCAGAGGG + Intergenic
982646260 4:158027723-158027745 CAGATGATATGGAACCCAGAGGG + Intergenic
983420260 4:167507391-167507413 CACCTGATGTGGAGCCCAGAGGG - Intergenic
984236000 4:177159743-177159765 CAGCCAGCGTGGAGCTCAGAGGG + Intergenic
984842131 4:184078534-184078556 CAGCAGGTGAGGAGACCAGCAGG + Intergenic
985372896 4:189305739-189305761 CAGCAGTTGTCGAGACCAGATGG + Intergenic
1202763633 4_GL000008v2_random:133402-133424 CAGGTGATGTGGAGCCCAGAGGG - Intergenic
985552363 5:540236-540258 GAGCGGGTGAGGGGCCCAGAGGG - Intergenic
985969764 5:3365801-3365823 AAGCTACTGTGGAGCCCAGCGGG - Intergenic
986343736 5:6815089-6815111 CAGCTGGTCTTCAGCCCAAATGG + Intergenic
986484098 5:8217904-8217926 CAGCTGGTCAGCAGCTCAGATGG - Intergenic
986754707 5:10824329-10824351 CAGATGATGTGGGGCCCAGAGGG - Intergenic
986985305 5:13494136-13494158 CAGCCTGTATAGAGCCCAGAGGG - Intergenic
987990983 5:25212490-25212512 CAGCCAGTGCAGAGCCCAGAGGG + Intergenic
988069441 5:26267443-26267465 CACCTGCTCTGGAGCCCAGTAGG - Intergenic
988163531 5:27552117-27552139 CAGACTGTGTGGAGCCTAGAGGG - Intergenic
988200790 5:28066330-28066352 AAGCTGATGTATAGCCCAGAGGG + Intergenic
988252760 5:28781748-28781770 CAGATGGTGTGGCTCCCAGGTGG - Intergenic
988336340 5:29913599-29913621 CAGCTGATGTGGGGCCCAGAGGG + Intergenic
989693348 5:44171015-44171037 CAGCTGATGTGGACTCCAGAGGG + Intergenic
990134715 5:52631370-52631392 CAGCTTGTGTGGAGCTCAGAGGG - Intergenic
990367036 5:55081484-55081506 CAGCGGGGGTGGAGCCAAGATGG - Intergenic
991028139 5:62052594-62052616 CAGCCTGTGTGGAGCCCATCAGG - Intergenic
991243894 5:64489077-64489099 CAGCCTGTGTAGAGCCCAGAGGG + Intergenic
991577653 5:68122017-68122039 CAGCTGATGTGGAGCCCAGAGGG + Intergenic
991978194 5:72203725-72203747 CTGCTGCTGAGGAGCCCAGCCGG + Exonic
992351506 5:75933684-75933706 CAGTTGGCCTGGAGCCAAGATGG - Intergenic
992357834 5:76003816-76003838 CATAGGGTGTGGAGCTCAGAGGG + Intergenic
992633993 5:78709754-78709776 CAACTGGGGTGGAGCCAAGATGG + Intronic
993228834 5:85204958-85204980 CAGCCTGTGTGGAGCCCAGAGGG - Intergenic
993311371 5:86337587-86337609 CAGGTGATGTAGAGCCCACAGGG + Intergenic
993429422 5:87813807-87813829 CAGCCTCTGTGGAGCACAGAGGG + Intergenic
994597616 5:101859982-101860004 CAGCTGATGTGAAGTTCAGAGGG + Intergenic
994970410 5:106730382-106730404 CAGCTAGTGTGGAGGCCAGAGGG + Intergenic
995187897 5:109290558-109290580 CAGCTGATGTGGAGCCCAAAGGG + Intergenic
995691329 5:114829544-114829566 CAGCTGATGTGGTGCCCAGAGGG + Intergenic
996663075 5:126027117-126027139 CAGCTGGTGTGGAGCCCAGAGGG + Intergenic
996888620 5:128389630-128389652 CAGCCTGTGCAGAGCCCAGAGGG - Intronic
996954325 5:129164674-129164696 CAGCTGATGTGGAGCCCAGGGGG - Intergenic
997258047 5:132444252-132444274 CTACTGGTGTGAAGCCCAGCCGG - Intronic
998099441 5:139419749-139419771 CAGCTGGTGGGGAGAGGAGAGGG + Intronic
998276029 5:140753986-140754008 CAGCTGGTGCAGAGCCCAGAGGG - Intergenic
998743929 5:145235413-145235435 CAGTTGCTGTCAAGCCCAGAGGG + Intergenic
998756025 5:145380072-145380094 CAGCTGATGTAGAGCCCAGAGGG - Intergenic
999019931 5:148154162-148154184 CATTTGGTGTAGAGCCCAGAGGG + Intergenic
999403199 5:151283366-151283388 CAGCAGGTGTGAAGTCCTGATGG + Intronic
1000642419 5:163718460-163718482 CAGCGTCTGTGGAGCCCTGAGGG + Intergenic
1001176001 5:169469463-169469485 CAGCTACTCAGGAGCCCAGAAGG + Intergenic
1001187542 5:169589532-169589554 TAGCTGGTGTAAAGCCCATAAGG - Intronic
1002043618 5:176530540-176530562 CAGCTGCCCTGGAGCCCAGGTGG + Intronic
1003527686 6:6911550-6911572 CAGCTGGTGTCGGGGCCAGTGGG + Intergenic
1005101009 6:22172488-22172510 AAGGCGGTGTGGAGCCAAGATGG - Intergenic
1005784582 6:29229899-29229921 CAGCTGCTGTGGAACCTAAAAGG - Intergenic
1006515908 6:34545418-34545440 CTGCTTGTGTTGAGGCCAGATGG - Intronic
1006604346 6:35245300-35245322 CAGCTGGTGTGGAGTGCATCTGG + Exonic
1006931208 6:37689604-37689626 CAGCTGGTGTGGGGCAGAGCTGG + Intronic
1007314939 6:40979594-40979616 CAGGTAGTGTGGAGCCCAGAGGG - Intergenic
1007353645 6:41294248-41294270 CAGCCTGTGTAGAGCCCAGAGGG + Intergenic
1007711276 6:43825851-43825873 CAGGTGGTGTGGAGCTCTGGGGG + Intergenic
1008332462 6:50260682-50260704 CAGCTGATGTGAAGACCAGAGGG - Intergenic
1009546718 6:65030039-65030061 CAGCCTGTGTGGATTCCAGAGGG + Intronic
1009596743 6:65745860-65745882 CAACTGATGTGGAGCCCACAGGG + Intergenic
1009732188 6:67622477-67622499 CTGCAGGGGTGGAGCCCACATGG + Intergenic
1010547186 6:77173021-77173043 CAGCTGATGTGGAGCCCAGAGGG - Intergenic
1010682131 6:78809358-78809380 CAGCTGGCGTGAAGACCAGAGGG - Intergenic
1011024439 6:82851937-82851959 GTGCTGGGGTGGAGCCAAGATGG + Intergenic
1011792730 6:90915692-90915714 CAGCCGGTGTGGAGCCCTTGTGG + Intergenic
1012490818 6:99780632-99780654 CAGCCAATGTAGAGCCCAGAGGG - Intergenic
1012616478 6:101284432-101284454 CAGCTGATGTGGAGCCCAGTGGG + Intergenic
1012821915 6:104095441-104095463 AAGCGGGGGTGGAGCCAAGATGG + Intergenic
1014183347 6:118408363-118408385 CAGCTAATGTGGAGCCCAGAGGG + Intergenic
1014374762 6:120659150-120659172 CTGCAGGGGTGGAGCCCTGATGG - Intergenic
1017006031 6:150028606-150028628 CAGCTGGTCTGGGCCCCAGCAGG + Intergenic
1018998993 6:168731141-168731163 CACCTGCTATGGAGGCCAGACGG + Intergenic
1019462838 7:1170210-1170232 CAGCAGGTGTGGCAGCCAGACGG - Intergenic
1019529397 7:1495966-1495988 CAGCTGGGGTGAGGCCCGGATGG + Intronic
1021156299 7:17215214-17215236 AAGCGGGGGTGGAGCCAAGATGG + Intergenic
1021351233 7:19596150-19596172 CAGCTGATGTGGAGCCCAGAAGG - Intergenic
1021425540 7:20495715-20495737 CAGCTAGTGCAGAGCCCAGAGGG + Intergenic
1021967291 7:25933007-25933029 CAGTCGATGTAGAGCCCAGAGGG + Intergenic
1022108303 7:27212626-27212648 CAGAGGGTGTGGGGCCTAGAGGG + Intergenic
1022971242 7:35519269-35519291 CAGATGGTTTGGAGCACTGATGG + Intergenic
1023241327 7:38151078-38151100 CAGCTGATACGGAGCCCAGAGGG + Intergenic
1023248804 7:38235553-38235575 CGGCTTGTGTGGAGCACAGCTGG + Intergenic
1023805797 7:43872191-43872213 GAGGTGGTGTGGAACCCAGGGGG - Intronic
1023997880 7:45173126-45173148 TAGATGGAGTGGAACCCAGAGGG - Intronic
1024385709 7:48748955-48748977 CAGCAGGTGCAGAGCCCAGAGGG - Intergenic
1025158953 7:56636373-56636395 CAGCTCATGTGGTGCCCAGAGGG + Intergenic
1025727648 7:64081857-64081879 CAGCTCATGTGGTACCCAGAGGG - Intronic
1025756772 7:64351719-64351741 CAGCTCATGTGGTGGCCAGAGGG - Exonic
1026296411 7:69056752-69056774 TCACTGGTGGGGAGCCCAGACGG - Intergenic
1027627566 7:80564340-80564362 CAGCTCATGTTGTGCCCAGAGGG - Intronic
1028008821 7:85614589-85614611 CAGCTTATGTGGAGCCCAGAAGG + Intergenic
1028082972 7:86600398-86600420 CAGCTGATGTTGAGCCCAGAGGG + Intergenic
1028347341 7:89798787-89798809 CAGCTGGTACAGAGCCCAGAGGG - Intergenic
1028639676 7:93028844-93028866 CAGCCAGTGCAGAGCCCAGAGGG + Intergenic
1031329988 7:120452728-120452750 CAGCTAGTGAAGAGCACAGAGGG + Intronic
1032310344 7:130780397-130780419 CAGCCTGTGTGGAGCCCAGAGGG - Intergenic
1032433303 7:131880347-131880369 AAGCTGGAGTGGAGCCCAGGAGG - Intergenic
1032455078 7:132067062-132067084 CAGCCAGAGTGGAGCCCAGCAGG + Intergenic
1032504169 7:132423394-132423416 CAGATTGTTTGGAGCCCTGAGGG - Intronic
1032999904 7:137492640-137492662 CAGCCAGTGTGGAGCCCAGAGGG + Intronic
1034257736 7:149733721-149733743 GAGCTGCAGTGGAGCCCAGGAGG - Exonic
1034366193 7:150550885-150550907 CAGCCAGTGTGGAGCCCAGAGGG + Intergenic
1034461465 7:151200065-151200087 CTGCAGGGGTGGACCCCAGAGGG - Intronic
1035167683 7:157001129-157001151 CAGCTACTGCGGAGCCCAGGCGG - Intronic
1035327180 7:158072759-158072781 CAGCTGCTGTGTAGCCCTGTAGG + Intronic
1035717339 8:1764081-1764103 CAGCTGAGGGGGAACCCAGATGG + Intronic
1036370202 8:8155946-8155968 TAGCAGGAGTGGAGCCAAGATGG + Intergenic
1036459704 8:8941065-8941087 CAGCTGGTTTGGGGCCACGAGGG - Intergenic
1036880690 8:12509685-12509707 TAGCAGGAGTGGAGCCAAGATGG - Intergenic
1037373669 8:18206045-18206067 CAGCCGATGTGGAGCCCAGAGGG - Intronic
1037842706 8:22256552-22256574 CAGCTGGTGTGGAGATGAGGCGG + Intergenic
1038349809 8:26765531-26765553 CAGCTCCAGTGGAGCCCAGTTGG - Intronic
1038456155 8:27673064-27673086 CACCTGGAGTGCAGCCCTGAAGG - Intronic
1038859945 8:31375934-31375956 TAGCCTGTGAGGAGCCCAGAGGG - Intergenic
1039264355 8:35808691-35808713 CAACTAAGGTGGAGCCCAGATGG + Intergenic
1040087898 8:43364897-43364919 CAGCTGATGCGGAGCCCAAAGGG + Intergenic
1040372241 8:46788416-46788438 CAGCTCATGTGGTGCCCAGAGGG - Intergenic
1040380615 8:46868432-46868454 CAGCTCATGTGGTGCCCAGAGGG + Intergenic
1040482694 8:47841221-47841243 CAGCCTATGTGGAGCCCAGCAGG + Intronic
1041022104 8:53648382-53648404 AAGCTGGTGTGGAGGCCAGGAGG - Intergenic
1041404542 8:57483552-57483574 CAAATAATGTGGAGCCCAGAGGG + Intergenic
1042750558 8:72153448-72153470 CAGCTTGGGAGGAGCCAAGATGG - Intergenic
1042768828 8:72356554-72356576 CTGCTGTAGTGTAGCCCAGATGG + Intergenic
1042976820 8:74478717-74478739 CAGCTGGTGCGGAGCCCAGAGGG - Intronic
1043336243 8:79180286-79180308 CTGCTGGGGTGGAGCCCTCATGG - Intergenic
1043398083 8:79857916-79857938 CAGCTGGTCTGGAGAACAGCCGG - Intergenic
1043656483 8:82674204-82674226 CAACTGATGTGGAGCCCAGAGGG + Intergenic
1043698472 8:83251818-83251840 CAGCTGATATGGAGCCCAGAAGG - Intergenic
1044127283 8:88474192-88474214 CATCTGACGTGGAGCCCAGAGGG + Intergenic
1044303938 8:90616671-90616693 CTGCAGGGGTGGAGCCCTGAGGG + Intergenic
1044313699 8:90726175-90726197 CAGCTGATGTGGAGCCCAGAGGG + Intronic
1045607110 8:103789279-103789301 CTGCTGGGGAGGAGCCAAGATGG - Intronic
1045939199 8:107718074-107718096 CAGAGGGAGTGGAGCCAAGATGG - Intergenic
1046895024 8:119463249-119463271 CAGCTGATGTGGAGCCCAGAGGG + Intergenic
1048119564 8:131564043-131564065 CAGCCAGCGTGGAGCCCAGAGGG - Intergenic
1048575587 8:135687349-135687371 TAGCTGGTATGAAGCCCAGTTGG - Intergenic
1048995865 8:139793404-139793426 CTGCTGGGGTGGAGCCCTGTGGG - Intronic
1049047758 8:140166079-140166101 CAGGTGGTGTGGAGTCCAGCTGG + Intronic
1049128027 8:140810226-140810248 CAGCTGAGGTGGAGCCCAGAGGG + Intronic
1049707393 8:144049234-144049256 CAGCTGGTGCAGGGCCCAGTAGG - Intergenic
1050410793 9:5363041-5363063 CAGCTGGAGAGGGGCACAGAAGG + Intronic
1050424761 9:5501807-5501829 CAGGTGATGTGGAGCCCAGTAGG + Intergenic
1050965428 9:11795584-11795606 CAGTCTGTATGGAGCCCAGAGGG - Intergenic
1051097010 9:13477637-13477659 CAGCCTATGTGGAGCCCAGAGGG - Intergenic
1051116325 9:13698154-13698176 CAGCTGATGTGTAGCCCAGAGGG - Intergenic
1051899659 9:22025094-22025116 CAGCTGATGTGGAGCCCAGAGGG - Intronic
1052534116 9:29726352-29726374 CAGCTGATGTGGAGCCCAGAAGG + Intergenic
1053114701 9:35490440-35490462 CATCTGGGGTGGCGCCCAAAGGG - Intronic
1053314601 9:37040929-37040951 CAGCTGGCGTGGAGGGGAGAGGG + Intergenic
1056207174 9:84331448-84331470 CAGCAGGTTTGGATCCCTGATGG + Intronic
1056891474 9:90497781-90497803 CAGATGGTGTGGGACCCAGATGG + Intergenic
1057052322 9:91935284-91935306 CAGCTTTTGTGGAGCCCGCAGGG - Intronic
1057108567 9:92445089-92445111 CAGCTGGTGTGGAGCCCAGAGGG - Intronic
1057434680 9:95028994-95029016 CAGCTGGTGAGGAACGCACATGG + Intronic
1057805328 9:98215854-98215876 CAGCTGGTGGGGAGCTCAGATGG - Intronic
1057956823 9:99416427-99416449 AAGCTGGTGTCGGGCCCTGAAGG - Intergenic
1058453078 9:105114915-105114937 CAAGTGCTGTGGAGCACAGAGGG + Intergenic
1058456094 9:105139497-105139519 CAGTTAGTGAGGAGCCCTGAAGG - Intergenic
1058711576 9:107683706-107683728 CAGCTGGTGGCAAGGCCAGAGGG - Intergenic
1058902829 9:109456969-109456991 CAGCTGGGGCGGATCCTAGAGGG + Intronic
1060539292 9:124419005-124419027 CAGACGGTGTGGAGCCCATCGGG + Intergenic
1060591604 9:124820511-124820533 CAGCTGGTGTGGACCCGGCATGG + Intergenic
1060603525 9:124894484-124894506 CAGCTGCTTGGGAGCCCAGGAGG - Intronic
1060778979 9:126397977-126397999 GAGCTGGTGTGCAGCCCTGCAGG - Intronic
1060939684 9:127536221-127536243 CCCCAGGTGTGGAGGCCAGAGGG + Intronic
1061570233 9:131473621-131473643 CCCCCTGTGTGGAGCCCAGAGGG + Exonic
1203527851 Un_GL000213v1:106287-106309 CAGCTGATGTGGAGCCCGGAGGG - Intergenic
1203544387 Un_KI270743v1:118275-118297 CAGGTGATGTGGAGCCCAGAGGG - Intergenic
1186453892 X:9695709-9695731 CAGCTGGTGCAGAGTACAGAGGG + Intronic
1186685724 X:11922729-11922751 CAGCTGATGTGGAGCCCAGAGGG + Intergenic
1187644102 X:21328196-21328218 CAGCCAGAGTGGAGCCCAGAGGG + Intergenic
1187801367 X:23067433-23067455 CAGCCTGTGTGGAGCCCAGAGGG + Intergenic
1188147403 X:26630537-26630559 CAGTTTGCATGGAGCCCAGAGGG - Intergenic
1188492997 X:30755821-30755843 CAGCTGGTGTGGAGCCCAGAGGG + Intergenic
1188629204 X:32330519-32330541 CAGCTGGAAGGGAGCTCAGATGG - Intronic
1188833694 X:34931703-34931725 CAGCCAGTGCAGAGCCCAGAGGG + Intergenic
1188852589 X:35150550-35150572 CAGCCAATGTGGAGCCCAGAGGG + Intergenic
1189062386 X:37768607-37768629 CCACTGGGGTGGAGCCAAGATGG + Intronic
1189653084 X:43211093-43211115 CAGCCTGTGTGGAGTCCAGAGGG + Intergenic
1189678243 X:43486542-43486564 CAGCCTGTGTGGAGCCCAGAGGG + Intergenic
1189891859 X:45610921-45610943 CAGCCTGTGTGGAGCCCAGAGGG - Intergenic
1189940733 X:46117899-46117921 CAGTGGCTGTGGAGCACAGAGGG - Intergenic
1190085704 X:47393648-47393670 CAGCTGGGTTGGAGCCCAGGAGG - Intronic
1190604477 X:52126648-52126670 CAGCCTGCATGGAGCCCAGAGGG + Intergenic
1191089591 X:56606012-56606034 CAGCCAGTCTGAAGCCCAGAGGG - Intergenic
1191137581 X:57082602-57082624 CAGCTGATGTGGAGCCCAGAGGG + Intergenic
1191155302 X:57266808-57266830 CAGATGATGTGGAGCCCAGGGGG + Intergenic
1191207973 X:57854028-57854050 CATCTGGTGCAGAGCCCAGGGGG - Intergenic
1191609945 X:63101772-63101794 CAGCTAATGTGGACCCTAGAGGG + Intergenic
1191743649 X:64463400-64463422 CAGCAGATATGGATCCCAGAGGG - Intergenic
1191800494 X:65073646-65073668 CAGTTGGCGTAGAGCCCAGAGGG - Intergenic
1191816684 X:65253446-65253468 CAGCTGGCGCAGAGACCAGAGGG + Intergenic
1191933898 X:66405266-66405288 CAGCTAATGTGGAACCCAGAGGG - Intergenic
1192766556 X:74146220-74146242 CAGCCAGTATGGAGCCTAGAGGG + Intergenic
1192926475 X:75759619-75759641 CAGCTGATATGGAGCCCAGAGGG + Intergenic
1192932645 X:75824348-75824370 CAACCTGTGTGGAGCCCAGAGGG - Intergenic
1192996869 X:76521097-76521119 CAGCCAGTGTGGAGCCCATAAGG - Intergenic
1193056669 X:77159741-77159763 CAGCCAGTGTCAAGCCCAGAGGG + Intergenic
1193341653 X:80355508-80355530 CAGCCTGTGCAGAGCCCAGAAGG - Intronic
1193406443 X:81107499-81107521 CTGCAGGTGTGGAGCCCTCATGG + Intergenic
1193514982 X:82452013-82452035 CAGCATGTGTGGAACCCAGGGGG + Intergenic
1193580711 X:83259740-83259762 CAGTTGATGTGGAGCCCAGAGGG + Intergenic
1193614121 X:83667217-83667239 TAGCTGATGTAGAGCCCAGAAGG - Intergenic
1193749756 X:85327073-85327095 CAGTCAGTGCGGAGCCCAGAGGG - Intronic
1193790319 X:85808700-85808722 CAGTTGAGGTGGAGCCCAGAGGG - Intergenic
1193823444 X:86194713-86194735 CAGCTGATGTGGAGCCCAGAGGG + Intronic
1193960029 X:87914260-87914282 CAGCTGATGTGGAGCCCAGAGGG + Intergenic
1194019150 X:88665931-88665953 CAGCCTGTGTGGAGTCCAGACGG + Intergenic
1194243526 X:91480675-91480697 CAGACTGTCTGGAGCCCAGATGG - Intergenic
1194247983 X:91538315-91538337 CAGATGATATGGAGCCCAGAGGG + Intergenic
1194310623 X:92301452-92301474 CAGCCTATGTGGAGCCCAGAAGG - Intronic
1194365719 X:93011288-93011310 CAGCCAGTGTAGAGTCCAGAGGG - Intergenic
1194512656 X:94814649-94814671 CAGCTAGTTTGGAGCCCAGAGGG - Intergenic
1194549100 X:95274052-95274074 CCGCTGATGTGGAGCCCAGAGGG + Intergenic
1194781403 X:98029034-98029056 CAGCTGATGTGGAGCCCAGAGGG - Intergenic
1194917579 X:99723711-99723733 CAGCTGATGCAGAGCCGAGAGGG + Intergenic
1195151177 X:102071855-102071877 CAGCTTGTGCAGAGCCCAGAAGG + Intergenic
1195270070 X:103220512-103220534 CAGCTAGAGTGGAGGCCAGAGGG + Intergenic
1195548307 X:106138392-106138414 CAGTTGATGTGGAGCCCAGAGGG + Intergenic
1195625892 X:107005668-107005690 GAGCTGGAGAGGAGCCGAGAGGG - Intergenic
1195971717 X:110480538-110480560 CAGCTGCAGGGGAGCACAGACGG - Intergenic
1195971726 X:110480574-110480596 CAGCCTGCATGGAGCCCAGAGGG - Intergenic
1196468094 X:115993355-115993377 CAGCTGATGAGGAACCCAAATGG + Intergenic
1196478727 X:116121198-116121220 CAGCGGAGGTGGAGCCAAGATGG + Intergenic
1196554363 X:117069955-117069977 CAGCTCGTGCAGAGCTCAGAGGG + Intergenic
1196574510 X:117302469-117302491 CAGTCTGTGTGAAGCCCAGAGGG - Intergenic
1196586869 X:117440081-117440103 CAGCCTGTGTGGAGCCCAGAGGG + Intergenic
1196899249 X:120367004-120367026 CAACTGATGTTGAGCCCAGTGGG - Intronic
1197014287 X:121604984-121605006 CAGCCTGTGAGGAGCCCAGCAGG - Intergenic
1197076901 X:122363922-122363944 CAGCTGATGTGGAGCCCAGAGGG - Intergenic
1197093851 X:122571464-122571486 CAGCTTGTGAGGAACTCAGAGGG + Intergenic
1197177445 X:123500707-123500729 CAGACTGTGTGGAGCCCCGAGGG - Intergenic
1197374291 X:125663532-125663554 CAGCCTGTGTGGAGCACAAAGGG + Intergenic
1197378797 X:125713545-125713567 CAGCTAATGTGGAGCCCAAAGGG + Intergenic
1197422780 X:126258755-126258777 CAGCCTGTGTAGAGTCCAGATGG - Intergenic
1197790358 X:130248461-130248483 GAGCCAGAGTGGAGCCCAGAGGG + Intronic
1198759063 X:140012097-140012119 CAGCCAGTGTGGAGCCCAGAGGG - Intergenic
1198779681 X:140221475-140221497 CAGCCAGTGTGGAGCCCAGAGGG + Intergenic
1198891695 X:141403656-141403678 CAGCCTATGCGGAGCCCAGAGGG - Intergenic
1199400094 X:147389273-147389295 CAGCCGGTGTGGAGCCCAGAGGG + Intergenic
1199560920 X:149161629-149161651 CAGCTGGCGCAGAGCCCAGAGGG + Intergenic
1199640677 X:149858274-149858296 CAGCCTGTGCAGAGCCCAGATGG + Intergenic
1200562507 Y:4722050-4722072 CAGACTGTCTGGAGCCCAGATGG - Intergenic
1200566998 Y:4779844-4779866 CAGATGATATGGAGCCCAGAGGG + Intergenic
1200618905 Y:5415738-5415760 CAGCCTATGTGGAGCCCAGAAGG - Intronic
1200673937 Y:6127538-6127560 CAGCCAGTGTAGAGTCCAGAGGG - Intergenic
1202256638 Y:22928323-22928345 CAGCTTATGTGGTGACCAGAGGG - Intergenic
1202409629 Y:24562076-24562098 CAGCTTATGTGGTGACCAGAGGG - Intergenic
1202461154 Y:25108001-25108023 CAGCTTATGTGGTGACCAGAGGG + Intergenic