ID: 943158358

View in Genome Browser
Species Human (GRCh38)
Location 2:184214193-184214215
Sequence TTCCAAAAGATGAAGAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943158358_943158362 20 Left 943158358 2:184214193-184214215 CCTTCTTTCTTCATCTTTTGGAA No data
Right 943158362 2:184214236-184214258 ACAATTCTGCTTTGAATGCCTGG No data
943158358_943158359 -10 Left 943158358 2:184214193-184214215 CCTTCTTTCTTCATCTTTTGGAA No data
Right 943158359 2:184214206-184214228 TCTTTTGGAATAATTCCAATAGG No data
943158358_943158360 -5 Left 943158358 2:184214193-184214215 CCTTCTTTCTTCATCTTTTGGAA No data
Right 943158360 2:184214211-184214233 TGGAATAATTCCAATAGGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943158358 Original CRISPR TTCCAAAAGATGAAGAAAGA AGG (reversed) Intergenic
No off target data available for this crispr