ID: 943158360

View in Genome Browser
Species Human (GRCh38)
Location 2:184214211-184214233
Sequence TGGAATAATTCCAATAGGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943158358_943158360 -5 Left 943158358 2:184214193-184214215 CCTTCTTTCTTCATCTTTTGGAA No data
Right 943158360 2:184214211-184214233 TGGAATAATTCCAATAGGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943158360 Original CRISPR TGGAATAATTCCAATAGGAT TGG Intergenic
No off target data available for this crispr