ID: 943166940 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:184340894-184340916 |
| Sequence | CCTCACATCCAAAATTTGGA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 943166935_943166940 | 22 | Left | 943166935 | 2:184340849-184340871 | CCACTACCTACATATACTGCATT | No data | ||
| Right | 943166940 | 2:184340894-184340916 | CCTCACATCCAAAATTTGGATGG | No data | ||||
| 943166936_943166940 | 16 | Left | 943166936 | 2:184340855-184340877 | CCTACATATACTGCATTTCTTTC | No data | ||
| Right | 943166940 | 2:184340894-184340916 | CCTCACATCCAAAATTTGGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 943166940 | Original CRISPR | CCTCACATCCAAAATTTGGA TGG | Intergenic | ||
| No off target data available for this crispr | |||||