ID: 943166940

View in Genome Browser
Species Human (GRCh38)
Location 2:184340894-184340916
Sequence CCTCACATCCAAAATTTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943166935_943166940 22 Left 943166935 2:184340849-184340871 CCACTACCTACATATACTGCATT No data
Right 943166940 2:184340894-184340916 CCTCACATCCAAAATTTGGATGG No data
943166936_943166940 16 Left 943166936 2:184340855-184340877 CCTACATATACTGCATTTCTTTC No data
Right 943166940 2:184340894-184340916 CCTCACATCCAAAATTTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943166940 Original CRISPR CCTCACATCCAAAATTTGGA TGG Intergenic
No off target data available for this crispr