ID: 943171034

View in Genome Browser
Species Human (GRCh38)
Location 2:184400505-184400527
Sequence TTTCCATCAAACATTAAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943171034_943171037 11 Left 943171034 2:184400505-184400527 CCACATTTAATGTTTGATGGAAA No data
Right 943171037 2:184400539-184400561 CTGGTTTGACAGAGTTGACTGGG No data
943171034_943171036 10 Left 943171034 2:184400505-184400527 CCACATTTAATGTTTGATGGAAA No data
Right 943171036 2:184400538-184400560 ACTGGTTTGACAGAGTTGACTGG No data
943171034_943171035 -8 Left 943171034 2:184400505-184400527 CCACATTTAATGTTTGATGGAAA No data
Right 943171035 2:184400520-184400542 GATGGAAATAATGTTAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943171034 Original CRISPR TTTCCATCAAACATTAAATG TGG (reversed) Intergenic
No off target data available for this crispr