ID: 943171037 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:184400539-184400561 |
| Sequence | CTGGTTTGACAGAGTTGACT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 943171034_943171037 | 11 | Left | 943171034 | 2:184400505-184400527 | CCACATTTAATGTTTGATGGAAA | No data | ||
| Right | 943171037 | 2:184400539-184400561 | CTGGTTTGACAGAGTTGACTGGG | No data | ||||
| 943171033_943171037 | 12 | Left | 943171033 | 2:184400504-184400526 | CCCACATTTAATGTTTGATGGAA | No data | ||
| Right | 943171037 | 2:184400539-184400561 | CTGGTTTGACAGAGTTGACTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 943171037 | Original CRISPR | CTGGTTTGACAGAGTTGACT GGG | Intergenic | ||
| No off target data available for this crispr | |||||