ID: 943171037

View in Genome Browser
Species Human (GRCh38)
Location 2:184400539-184400561
Sequence CTGGTTTGACAGAGTTGACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943171034_943171037 11 Left 943171034 2:184400505-184400527 CCACATTTAATGTTTGATGGAAA No data
Right 943171037 2:184400539-184400561 CTGGTTTGACAGAGTTGACTGGG No data
943171033_943171037 12 Left 943171033 2:184400504-184400526 CCCACATTTAATGTTTGATGGAA No data
Right 943171037 2:184400539-184400561 CTGGTTTGACAGAGTTGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943171037 Original CRISPR CTGGTTTGACAGAGTTGACT GGG Intergenic
No off target data available for this crispr