ID: 943172238

View in Genome Browser
Species Human (GRCh38)
Location 2:184416502-184416524
Sequence CTAATTTTCTTTAAGTGTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943172235_943172238 26 Left 943172235 2:184416453-184416475 CCTTTAAGCTGGTAAAAAATCCT No data
Right 943172238 2:184416502-184416524 CTAATTTTCTTTAAGTGTCTAGG No data
943172236_943172238 6 Left 943172236 2:184416473-184416495 CCTCCACTTTGATATGTTAGATA No data
Right 943172238 2:184416502-184416524 CTAATTTTCTTTAAGTGTCTAGG No data
943172237_943172238 3 Left 943172237 2:184416476-184416498 CCACTTTGATATGTTAGATAAAG No data
Right 943172238 2:184416502-184416524 CTAATTTTCTTTAAGTGTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943172238 Original CRISPR CTAATTTTCTTTAAGTGTCT AGG Intergenic
No off target data available for this crispr