ID: 943173209

View in Genome Browser
Species Human (GRCh38)
Location 2:184431648-184431670
Sequence CACATACCACCTCATTTTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943173209_943173213 17 Left 943173209 2:184431648-184431670 CCCTTAAAATGAGGTGGTATGTG No data
Right 943173213 2:184431688-184431710 ATGTAGAAGAGGAATCAGAATGG No data
943173209_943173214 28 Left 943173209 2:184431648-184431670 CCCTTAAAATGAGGTGGTATGTG No data
Right 943173214 2:184431699-184431721 GAATCAGAATGGCTGAATAGTGG No data
943173209_943173212 6 Left 943173209 2:184431648-184431670 CCCTTAAAATGAGGTGGTATGTG No data
Right 943173212 2:184431677-184431699 GGTTGAAGAGCATGTAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943173209 Original CRISPR CACATACCACCTCATTTTAA GGG (reversed) Intergenic
No off target data available for this crispr