ID: 943173210

View in Genome Browser
Species Human (GRCh38)
Location 2:184431649-184431671
Sequence ACACATACCACCTCATTTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943173210_943173214 27 Left 943173210 2:184431649-184431671 CCTTAAAATGAGGTGGTATGTGT No data
Right 943173214 2:184431699-184431721 GAATCAGAATGGCTGAATAGTGG No data
943173210_943173213 16 Left 943173210 2:184431649-184431671 CCTTAAAATGAGGTGGTATGTGT No data
Right 943173213 2:184431688-184431710 ATGTAGAAGAGGAATCAGAATGG No data
943173210_943173212 5 Left 943173210 2:184431649-184431671 CCTTAAAATGAGGTGGTATGTGT No data
Right 943173212 2:184431677-184431699 GGTTGAAGAGCATGTAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943173210 Original CRISPR ACACATACCACCTCATTTTA AGG (reversed) Intergenic
No off target data available for this crispr