ID: 943173214

View in Genome Browser
Species Human (GRCh38)
Location 2:184431699-184431721
Sequence GAATCAGAATGGCTGAATAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943173210_943173214 27 Left 943173210 2:184431649-184431671 CCTTAAAATGAGGTGGTATGTGT No data
Right 943173214 2:184431699-184431721 GAATCAGAATGGCTGAATAGTGG No data
943173209_943173214 28 Left 943173209 2:184431648-184431670 CCCTTAAAATGAGGTGGTATGTG No data
Right 943173214 2:184431699-184431721 GAATCAGAATGGCTGAATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943173214 Original CRISPR GAATCAGAATGGCTGAATAG TGG Intergenic
No off target data available for this crispr