ID: 943179158

View in Genome Browser
Species Human (GRCh38)
Location 2:184521310-184521332
Sequence AAATGGAAGAGGAAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943179152_943179158 3 Left 943179152 2:184521284-184521306 CCCAAAGTAATCACAAGAGATCT No data
Right 943179158 2:184521310-184521332 AAATGGAAGAGGAAGGTGGATGG No data
943179153_943179158 2 Left 943179153 2:184521285-184521307 CCAAAGTAATCACAAGAGATCTT No data
Right 943179158 2:184521310-184521332 AAATGGAAGAGGAAGGTGGATGG No data
943179151_943179158 22 Left 943179151 2:184521265-184521287 CCTAAATTATACAGGTAGACCCA No data
Right 943179158 2:184521310-184521332 AAATGGAAGAGGAAGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943179158 Original CRISPR AAATGGAAGAGGAAGGTGGA TGG Intergenic
No off target data available for this crispr