ID: 943184439

View in Genome Browser
Species Human (GRCh38)
Location 2:184588457-184588479
Sequence TTGTTTATGAATACAGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943184436_943184439 -2 Left 943184436 2:184588436-184588458 CCTAATTTCCTTCATGTTGTATT No data
Right 943184439 2:184588457-184588479 TTGTTTATGAATACAGAGGCAGG No data
943184437_943184439 -10 Left 943184437 2:184588444-184588466 CCTTCATGTTGTATTGTTTATGA No data
Right 943184439 2:184588457-184588479 TTGTTTATGAATACAGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943184439 Original CRISPR TTGTTTATGAATACAGAGGC AGG Intergenic
No off target data available for this crispr