ID: 943184989

View in Genome Browser
Species Human (GRCh38)
Location 2:184597272-184597294
Sequence TGCAGTTTGTTCTGACATAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943184986_943184989 3 Left 943184986 2:184597246-184597268 CCAAATAAACACAGTTTATATCA 0: 1
1: 0
2: 2
3: 60
4: 404
Right 943184989 2:184597272-184597294 TGCAGTTTGTTCTGACATAGGGG 0: 1
1: 0
2: 0
3: 5
4: 127
943184985_943184989 4 Left 943184985 2:184597245-184597267 CCCAAATAAACACAGTTTATATC 0: 1
1: 0
2: 6
3: 39
4: 423
Right 943184989 2:184597272-184597294 TGCAGTTTGTTCTGACATAGGGG 0: 1
1: 0
2: 0
3: 5
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943184989 Original CRISPR TGCAGTTTGTTCTGACATAG GGG Intergenic
906248111 1:44291324-44291346 TGCTGTGTCTTCTGACATGGTGG - Intronic
917981996 1:180275482-180275504 TGCAGTCTGTTCAGCCATATCGG + Exonic
920972896 1:210757788-210757810 TGCTGTTTGTTCAGAGACAGAGG - Intronic
921735768 1:218626449-218626471 AGCAGTTTCTTCAGACATAAAGG + Intergenic
922997639 1:229977721-229977743 TGCAGTTTGTTCATCCATTGAGG + Intergenic
1063146814 10:3302397-3302419 TGCAGTTGATTCTGACACTGTGG + Intergenic
1067706455 10:48610019-48610041 TGCAGGCTGCTCTGTCATAGAGG + Intronic
1067769491 10:49113093-49113115 TGCAGTTTCTTCAGGCAGAGAGG - Intronic
1068272855 10:54752554-54752576 AGAAGTTTTTTCTGACATATAGG - Intronic
1069871261 10:71534617-71534639 AACTGTTGGTTCTGACATAGGGG - Intronic
1071781457 10:88850477-88850499 CCCAGGTGGTTCTGACATAGGGG - Intronic
1073192562 10:101662127-101662149 TGGAGTTTTCTCTGACAGAGAGG - Intronic
1073883644 10:108012009-108012031 TGCATTTTGTTCTTATATAAAGG + Intergenic
1074007004 10:109436855-109436877 TGCAGTGTGTTCTGCAAAAGTGG - Intergenic
1074831776 10:117254582-117254604 CGCAGTTTGCACTGACACAGAGG + Intronic
1075962715 10:126583193-126583215 TGCAGTTTGTTTTGGCAAAGTGG - Intronic
1076388830 10:130080658-130080680 TGAAGTGTGTTCTGACATCAGGG - Intergenic
1081663803 11:44904642-44904664 TGCATTTTGGTCTGAGCTAGAGG - Intronic
1082856398 11:57811047-57811069 TAAAGTATGTTATGACATAGAGG - Intronic
1084787589 11:71452549-71452571 TGCAGTTTGGTATTCCATAGTGG - Intronic
1086284663 11:85233143-85233165 TTCCTTTTGTTCTGACATATGGG + Intronic
1089249260 11:117145539-117145561 GGCACATTGTTCTGACATAAAGG + Intronic
1092888170 12:12943682-12943704 TTCAGTTTGTTCTGCCATGAAGG - Intronic
1095409966 12:41910914-41910936 TGCATTTTGTTTGGACTTAGTGG - Intergenic
1095444391 12:42269756-42269778 TTCACTGTGTTCTCACATAGTGG - Intronic
1095496654 12:42791460-42791482 CCCAGTTTGGTCTGACACAGAGG + Intergenic
1098718339 12:73861066-73861088 TTCTCTTTGTTCTCACATAGTGG - Intergenic
1101525880 12:105529917-105529939 TGCAGTTTTTGCTGACATCTTGG + Intergenic
1102247730 12:111365901-111365923 GTCAGTTTGTCCTGACCTAGTGG + Intronic
1107083120 13:36396158-36396180 TGCAGCTTGTCCTGGCATTGTGG - Intergenic
1107532554 13:41297919-41297941 TGCAGTTTATATTGTCATAGAGG - Intergenic
1108775179 13:53757306-53757328 GGCAGTTTGTTCTGGGAAAGGGG + Intergenic
1109114005 13:58357728-58357750 TGGAGTTGGATTTGACATAGTGG - Intergenic
1114152244 14:20055983-20056005 TGCAGTTAATTGTAACATAGAGG + Intergenic
1115464529 14:33700286-33700308 TGCAGTTTGCCCTGTCATCGTGG - Intronic
1117581097 14:57152579-57152601 TGAAATGTGTTCTAACATAGGGG + Intergenic
1118709424 14:68507561-68507583 TGCAGTTTCTTCTCATATTGAGG - Intronic
1124960464 15:34389674-34389696 TCCAGTTTCTTCTGCCATTGTGG + Exonic
1124977093 15:34535895-34535917 TCCAGTTTCTTCTGCCATTGTGG + Exonic
1126073892 15:44889679-44889701 TGCAGGTTATTCTGACTTTGAGG + Intergenic
1129937272 15:79461083-79461105 TCCCGTTTGTTCAGACATAGTGG + Intronic
1130529545 15:84735693-84735715 TGCATTATGGTATGACATAGTGG - Intergenic
1135732744 16:24908149-24908171 AGCACTTGGTTCTGGCATAGTGG - Intronic
1136094617 16:27946004-27946026 TGCTGTGTGTTCTGACCTGGCGG - Intronic
1149604075 17:57912695-57912717 TGCAGTTTATTTTTACACAGTGG - Intronic
1150194298 17:63279105-63279127 TGATGTTTGTTCTTCCATAGGGG - Intronic
1151401688 17:73859852-73859874 GGAAGTTTGTTCTGGCAGAGGGG - Intergenic
1152841524 17:82571880-82571902 TTCAGTTTGTTGTTAAATAGAGG + Intronic
1154020705 18:10662045-10662067 TGCAGATGGTTCTGACATCAGGG - Intergenic
1155252986 18:23969078-23969100 TGCAGTGTCTTCTGACCAAGGGG - Intergenic
1155924872 18:31644904-31644926 TTCAGTTTGTTCTGGCATTGGGG - Intronic
1157542700 18:48523187-48523209 TGTTGTTTGTTCTGAGACAGTGG - Intergenic
1159318005 18:66805136-66805158 TGCAGTTTGTTTTGATTTTGGGG + Intergenic
1159435074 18:68405891-68405913 TCCACTTTGGTCTGACCTAGAGG + Intergenic
1159487981 18:69091385-69091407 TGCAGTCTGTTCTGTTATGGTGG - Intergenic
1159818158 18:73103446-73103468 TGCAGTTTATTCTGTTAAAGGGG + Intergenic
1160441196 18:78894198-78894220 TGGAGTGTGTGCTGACATACTGG - Intergenic
1164101164 19:22055616-22055638 TGCAGTTTCTCCTGAGAGAGTGG + Intronic
1168043038 19:53774220-53774242 TGCTGTTTTTACTGACAGAGAGG - Intergenic
1168369296 19:55818627-55818649 TACAGATTATTCTAACATAGAGG - Intronic
928191986 2:29179130-29179152 TGCAGTTTATTTTAATATAGAGG + Intronic
930600294 2:53435054-53435076 TGAAGTTTGGTCTGACCCAGGGG - Intergenic
932834799 2:75026414-75026436 TGCAGTTTGGTGTGAGAGAGAGG - Intergenic
933487441 2:82940627-82940649 TGCAGTTTATTATAACACAGTGG + Intergenic
938940033 2:136161948-136161970 TCAAGTTTGTTTTGACCTAGGGG + Intergenic
939741506 2:145913405-145913427 TTCAATTTGTTATTACATAGTGG - Intergenic
942562027 2:177229913-177229935 TCCAGTTCCTTCTAACATAGTGG + Intronic
942799998 2:179863538-179863560 TACAGTGTTATCTGACATAGGGG + Intergenic
943184989 2:184597272-184597294 TGCAGTTTGTTCTGACATAGGGG + Intergenic
944432300 2:199646436-199646458 TGCAGTTAATTCTGAGATGGGGG + Intergenic
944575778 2:201089866-201089888 TGAAGTTTGCTCTCACATGGCGG + Intergenic
1168827510 20:823532-823554 TGCAGCCTGTGCTGACAGAGAGG - Intergenic
1173658373 20:44716463-44716485 TGCTGTTTGTTCTTCCAAAGGGG + Intronic
1176350243 21:5787917-5787939 TGCAGTGTGGTCTGAGAGAGAGG - Intergenic
1176357057 21:5908501-5908523 TGCAGTGTGGTCTGAGAGAGAGG - Intergenic
1176544564 21:8185987-8186009 TGCAGTGTGGTCTGAGAGAGAGG - Intergenic
1176563515 21:8369032-8369054 TGCAGTGTGGTCTGAGAGAGAGG - Intergenic
1181472491 22:23149392-23149414 TGCAGTTTTTTCTGACCCTGAGG + Intronic
1184141488 22:42580294-42580316 TGCCGTGTGCTCTCACATAGAGG + Intergenic
1203249433 22_KI270733v1_random:102224-102246 TGCAGTGTGGTCTGAGAGAGAGG - Intergenic
953061151 3:39429562-39429584 TGCAGTTTGCACTAACACAGGGG - Intergenic
954601781 3:51876048-51876070 TGCAGATAGGTCAGACATAGGGG - Intergenic
960332609 3:116380626-116380648 TGGAGTTTGTACTTACAAAGTGG + Intronic
963312784 3:143726915-143726937 TGCAGTAAGTTCAGTCATAGGGG - Intronic
963586581 3:147198219-147198241 TGTAGTCTGTTGTGACACAGGGG - Intergenic
967631684 3:191750602-191750624 TCCAGTTTGTTCTGATTTTGAGG + Intergenic
970796841 4:19922940-19922962 GGAATTTTGTTCTGACATGGTGG - Intergenic
973337047 4:48967244-48967266 TGCAGTTGGTTATGAAATACAGG + Intergenic
974309041 4:60180469-60180491 TAAACTTTGTTCAGACATAGAGG + Intergenic
974750522 4:66134648-66134670 TTCTGTGTGTTCTCACATAGTGG + Intergenic
980504175 4:133693338-133693360 TGCACTGTGTTCTGACAGTGTGG - Intergenic
983459185 4:168006132-168006154 TCAAATTTGTTCTGACATTGTGG + Intergenic
987577009 5:19742647-19742669 TGCAGTTTGCTCAAAGATAGTGG + Intronic
992836487 5:80646737-80646759 TTCAGTTTCTTCTTACATTGGGG + Intronic
994141071 5:96342023-96342045 TTCAGTTTGGTCTCACATTGAGG - Intergenic
996019097 5:118572747-118572769 TTCAGTTTGGTCTGAAATGGAGG - Intergenic
996841552 5:127852404-127852426 TGCAGTGTTTTCTCACATGGGGG + Intergenic
999378950 5:151106561-151106583 TGCAGTTTGTTCTGGGAATGGGG - Intronic
1000427217 5:161105887-161105909 TGCAGATTGTCCTGACCCAGAGG + Intergenic
1007998572 6:46334901-46334923 TGCACTTGGTTCTGATATTGAGG - Intronic
1008038688 6:46774312-46774334 TAAAGTTGGTTGTGACATAGTGG + Intergenic
1009446535 6:63749329-63749351 TGCACTGTGATCTGACAGAGTGG + Intronic
1009564260 6:65291866-65291888 TGCACTATATTCTGACATACTGG - Intronic
1012491577 6:99788225-99788247 TGCAGTTTGCTCTGAGTGAGAGG + Intergenic
1018160031 6:161030803-161030825 TGGATTTTGTTCTGACATGTAGG + Intronic
1018241768 6:161783009-161783031 TGCAGTTTGTTTTGTCATTAGGG - Intronic
1020367847 7:7399475-7399497 TGCATATTGTTCTGAGCTAGAGG + Intronic
1023535395 7:41203408-41203430 TGCTGTCTGTTTTGAAATAGGGG + Intergenic
1024779460 7:52830322-52830344 TTCAGTTTGTTCTGAAATTTAGG - Intergenic
1027588735 7:80091016-80091038 TGCAGTTTCTTCTGCAATTGAGG - Intergenic
1027967262 7:85028075-85028097 TCCAGTTTGATATGACATATTGG + Intronic
1029890308 7:103921919-103921941 TGCAGTCTGTTCTGACCTCCTGG + Intronic
1030288900 7:107853035-107853057 TGCACTGTGTTTTGACATTGGGG + Intergenic
1030939851 7:115632426-115632448 TGCAGTTTGTGCTGAAAATGAGG - Intergenic
1031320246 7:120316637-120316659 TGCAATTTGTGTTGACATATTGG + Intronic
1038271543 8:26079822-26079844 TGCAGTTTGTTTTGATACATCGG - Intergenic
1046376365 8:113386722-113386744 TGCAGTTTATTCTGATGTAGTGG - Intronic
1048407788 8:134140638-134140660 TGGAGTTTGTGCTCCCATAGGGG - Intergenic
1048436863 8:134426260-134426282 TGCAGTGTTTGCTTACATAGGGG + Intergenic
1051552466 9:18345399-18345421 TTCAATTTTTTCTGAAATAGAGG - Intergenic
1052616594 9:30850353-30850375 TGCATTTTCTTCTAACACAGGGG - Intergenic
1056700241 9:88898314-88898336 TGCTGGTTAATCTGACATAGGGG + Intergenic
1062405212 9:136392973-136392995 TGCAGTGTCTGCTGACACAGAGG + Intronic
1203465827 Un_GL000220v1:85485-85507 TGCAGTGTGGTCTGAGAGAGAGG - Intergenic
1187644519 X:21332260-21332282 TGCAGTTTGGTCTGATAGAGTGG - Intergenic
1188597286 X:31916993-31917015 TACAGTGTGTTCTGAGATACTGG - Intronic
1188762301 X:34047907-34047929 TGCAGTAATTTCTAACATAGGGG - Intergenic
1190062592 X:47220663-47220685 CTCAGTTTGTGCTGACAGAGGGG + Intronic
1194525746 X:94975633-94975655 TGCACTGTGTTCTAACAGAGAGG + Intergenic
1197310115 X:124894317-124894339 TCCTGTTTGTTGTGACATGGAGG - Exonic
1198001458 X:132442713-132442735 TGCATTTTATTCAGAGATAGGGG + Intronic
1198850630 X:140962253-140962275 TGCAGTGTCTTCTGGCACAGAGG - Intergenic
1201591465 Y:15619458-15619480 TGCATTCAGTTCTGACCTAGTGG + Intergenic