ID: 943185167

View in Genome Browser
Species Human (GRCh38)
Location 2:184598315-184598337
Sequence CTGCGGCAGCGGCGCCGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 380}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943185147_943185167 30 Left 943185147 2:184598262-184598284 CCCCACCTTCCAGGAGTCTCCCA 0: 1
1: 1
2: 9
3: 27
4: 283
Right 943185167 2:184598315-184598337 CTGCGGCAGCGGCGCCGCGCGGG 0: 1
1: 0
2: 4
3: 40
4: 380
943185150_943185167 25 Left 943185150 2:184598267-184598289 CCTTCCAGGAGTCTCCCACTTGG 0: 1
1: 0
2: 1
3: 9
4: 167
Right 943185167 2:184598315-184598337 CTGCGGCAGCGGCGCCGCGCGGG 0: 1
1: 0
2: 4
3: 40
4: 380
943185153_943185167 21 Left 943185153 2:184598271-184598293 CCAGGAGTCTCCCACTTGGCGGT 0: 1
1: 0
2: 0
3: 3
4: 63
Right 943185167 2:184598315-184598337 CTGCGGCAGCGGCGCCGCGCGGG 0: 1
1: 0
2: 4
3: 40
4: 380
943185149_943185167 28 Left 943185149 2:184598264-184598286 CCACCTTCCAGGAGTCTCCCACT 0: 1
1: 0
2: 1
3: 19
4: 302
Right 943185167 2:184598315-184598337 CTGCGGCAGCGGCGCCGCGCGGG 0: 1
1: 0
2: 4
3: 40
4: 380
943185155_943185167 11 Left 943185155 2:184598281-184598303 CCCACTTGGCGGTGGCCGTCGCG 0: 1
1: 0
2: 0
3: 0
4: 28
Right 943185167 2:184598315-184598337 CTGCGGCAGCGGCGCCGCGCGGG 0: 1
1: 0
2: 4
3: 40
4: 380
943185158_943185167 -4 Left 943185158 2:184598296-184598318 CCGTCGCGTCCCCGGCCCTCTGC 0: 1
1: 0
2: 2
3: 20
4: 273
Right 943185167 2:184598315-184598337 CTGCGGCAGCGGCGCCGCGCGGG 0: 1
1: 0
2: 4
3: 40
4: 380
943185156_943185167 10 Left 943185156 2:184598282-184598304 CCACTTGGCGGTGGCCGTCGCGT 0: 1
1: 0
2: 0
3: 1
4: 28
Right 943185167 2:184598315-184598337 CTGCGGCAGCGGCGCCGCGCGGG 0: 1
1: 0
2: 4
3: 40
4: 380
943185148_943185167 29 Left 943185148 2:184598263-184598285 CCCACCTTCCAGGAGTCTCCCAC 0: 1
1: 0
2: 3
3: 18
4: 206
Right 943185167 2:184598315-184598337 CTGCGGCAGCGGCGCCGCGCGGG 0: 1
1: 0
2: 4
3: 40
4: 380

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943185167 Original CRISPR CTGCGGCAGCGGCGCCGCGC GGG Intergenic
900117037 1:1033326-1033348 CTGCGCCCGCGGCCCCGCCCTGG - Intronic
900171993 1:1273795-1273817 CGGCGGCGGCGGCGCTGCGGCGG - Exonic
900342977 1:2197395-2197417 CTGCGCCAGCCGGGCAGCGCAGG - Intronic
900677911 1:3900134-3900156 CGGCAGCAGCTGCGCCGGGCAGG - Intronic
900870466 1:5298545-5298567 CTGCGGCAGCGGGGCCATGGGGG + Intergenic
902783126 1:18717029-18717051 CGGCGGCGGCGGCGGAGCGCGGG - Intronic
903822114 1:26111177-26111199 CGGCGGCGGCGGCGCGGGGCTGG - Intronic
903907414 1:26696525-26696547 CGGCGGCAGCGGCCGAGCGCGGG + Exonic
904237341 1:29123856-29123878 CTGGCGCCGCAGCGCCGCGCGGG + Intronic
905449324 1:38046756-38046778 CGGCGGCGGCGGCGCGGCGCAGG - Exonic
906636947 1:47416275-47416297 CTGCGGTCCCGGAGCCGCGCGGG + Exonic
908129143 1:61057309-61057331 CTGCGGCAGCGGAGGCGCGGGGG + Intronic
908355845 1:63324099-63324121 CAGCGGCCGCGGCGGCGCCCAGG - Exonic
908555695 1:65254685-65254707 CTGAGGCAGGGGCGCAGCGGCGG + Intronic
908714285 1:67053743-67053765 CGGCGGCGGCGGCGCGGCGCCGG - Intronic
910657567 1:89633588-89633610 CTGCCGCTGCGGCGCGGCGTTGG - Intronic
911664717 1:100539556-100539578 CTGCGCCAGCAGCGCCGCGGCGG - Exonic
912993462 1:114511013-114511035 CGGGGGCAGCGGCAGCGCGCCGG - Exonic
913209459 1:116570869-116570891 CTGCCCCAGGGGCCCCGCGCCGG - Intronic
914242274 1:145859792-145859814 CGGCGGCCGCGGCTCCGCCCGGG + Intronic
915200117 1:154221012-154221034 CGGCGGCAGCGGCAGCGCGGCGG + Intronic
915934783 1:160084073-160084095 TGGCGGCCGCGGCGCCGCGGCGG - Exonic
917027620 1:170660617-170660639 CTGCAGGAGCGGCGCTGCACAGG + Intergenic
918015951 1:180632457-180632479 CGGCGGCAGCGGGGCTGCGGGGG - Intronic
919945896 1:202318818-202318840 CGGCGGCTTCGGCCCCGCGCAGG + Exonic
920260541 1:204685273-204685295 CGGCGGCGGCGGCGCTGCCCAGG + Intronic
920528482 1:206685273-206685295 CTGCGGCGGCGGGGCCGGGGCGG - Exonic
921355563 1:214281437-214281459 CGGCGGCGGCGGCGGCGGGCGGG + Intronic
921432798 1:215083015-215083037 CGGCGGCGGCGGCGGCGGGCAGG + Intronic
921472717 1:215567700-215567722 CTGCGGCAGCTTCCCCGCGGCGG + Exonic
921604759 1:217139699-217139721 CGGCGGCGGCGGCGGTGCGCGGG + Intergenic
922250574 1:223845794-223845816 CGGCGGCAGCGGCGGCGCGCGGG + Exonic
924552928 1:245095138-245095160 CTGCAGCAGCGGCCCTGCACGGG - Intronic
1063298158 10:4826630-4826652 CTGCGGCCGCGGCGTTGGGCGGG + Intronic
1065099926 10:22321960-22321982 TGGCGGCGGCGGCGCGGCGCGGG - Intronic
1065101594 10:22336535-22336557 CTGCCGCGGCGCGGCCGCGCCGG - Intergenic
1065188871 10:23192964-23192986 CGGCTGCGGCGGCGCGGCGCCGG + Exonic
1065214953 10:23439753-23439775 CGGCGGCAGCGGCGGCTTGCAGG - Exonic
1065573976 10:27100253-27100275 CGGCGGCAGAGGAGCAGCGCGGG - Exonic
1066080709 10:31928527-31928549 CGGCGGCGGCGGCGCCGCGGAGG - Intronic
1066429326 10:35336836-35336858 CGGCGGCGGCGGCGACGAGCGGG - Intronic
1067853292 10:49768927-49768949 CTGCCGCGGCCGCGCCCCGCTGG + Intergenic
1070311388 10:75276253-75276275 CAGCGGCTGCTGCGCGGCGCAGG + Intergenic
1070800831 10:79243557-79243579 CGGCGGCGGCGGCGGCGCGGGGG - Intronic
1072719583 10:97772171-97772193 CTGCGGCAGGGGAGCCGAGCCGG - Intergenic
1072757557 10:98030835-98030857 CAGTGGCCGCCGCGCCGCGCCGG - Intergenic
1073292924 10:102422138-102422160 CTGGCGCAGAGGCGCGGCGCTGG + Exonic
1074169677 10:110919819-110919841 CGGCGGCGGCGGCGCCTCCCAGG - Intronic
1074503353 10:114044999-114045021 CGGCGGCGGCGGCGGGGCGCGGG - Exonic
1076792890 10:132786138-132786160 CGGTCGGAGCGGCGCCGCGCGGG + Intergenic
1076916059 10:133423606-133423628 CTGCGACAGCGGCGCAGCCAAGG - Exonic
1077130881 11:971907-971929 CTGTGGGAGCGGCGCCTCTCAGG - Intronic
1078102771 11:8339592-8339614 CGGCGGCAGAGGCGCCCGGCTGG + Intergenic
1078210383 11:9265289-9265311 CTGCAGCGGCGGCGGCGCGGAGG - Exonic
1079297008 11:19242370-19242392 CCGAGGCAGCGCCGCCGCCCCGG - Intergenic
1079689401 11:23403531-23403553 CGGCGGCGGCGGCGGCGCGGGGG - Intergenic
1081699988 11:45146842-45146864 CTGCGGCAGCCGCGGGGCCCGGG - Intronic
1081831910 11:46121536-46121558 CGGCGGCGGCGGCGGCGGGCCGG - Intergenic
1083885741 11:65572683-65572705 CCTCGGCAGAGGCGCCGGGCGGG + Exonic
1084072393 11:66744828-66744850 CGGCGGCGGCGGCGGCGGGCGGG + Intronic
1085574380 11:77589609-77589631 CTGCGTCGACCGCGCCGCGCCGG + Intronic
1086243132 11:84720408-84720430 CTGCGGCAGTGGCAGCTCGCTGG + Intronic
1089046326 11:115504326-115504348 CGGCGGCGGCGGCGCCTCCCGGG - Exonic
1090238209 11:125164819-125164841 CGGCGGCGGCGGCGCGGCGGCGG + Intronic
1090832363 11:130428292-130428314 CTGCGGCGGTGGCTGCGCGCAGG + Exonic
1091616171 12:2052837-2052859 ATGTGGCTGCGGCGGCGCGCAGG - Intronic
1092451335 12:8605244-8605266 CTGCGGCGGCTGCACCGCGCCGG - Exonic
1092522949 12:9292320-9292342 TTGGGGCAGCAGCGCGGCGCAGG - Intergenic
1092544342 12:9439577-9439599 TTGGGGCAGCAGCGCGGCGCAGG + Intergenic
1094041119 12:26122635-26122657 CGGCGGCAGCGGCGGCGGCCCGG - Exonic
1094375402 12:29783748-29783770 CAGCGGCGGCGGCGGCGCGATGG - Exonic
1094470280 12:30796239-30796261 CTGCGGCCGCGGGGCGGCGGGGG - Intergenic
1094508606 12:31082490-31082512 TTGGGGCAGCAGCGCGGCGCAGG - Intronic
1095584525 12:43835916-43835938 CAAGGGCACCGGCGCCGCGCAGG - Intergenic
1095949303 12:47773284-47773306 ATGGGGCTGCGGCGCCGGGCGGG - Exonic
1096489572 12:52006483-52006505 GAGCGGCAGCGGGGCTGCGCAGG - Intergenic
1096983787 12:55743630-55743652 CTGCTGCAGCGGCGGCGCCTTGG - Exonic
1097106695 12:56630125-56630147 CTGAGGCAGCGGCGTCCAGCCGG + Intronic
1097264689 12:57738364-57738386 CGGCGACAGCGGAGCCGGGCCGG - Intronic
1098255399 12:68610940-68610962 CTGCCGCTGCCGCGCCGCTCCGG - Exonic
1100469057 12:94873833-94873855 CTGCGGCGGAGGCGCGGAGCCGG + Intergenic
1101593178 12:106140116-106140138 CGGCGGCAGCCACGCCGCGGTGG - Intergenic
1102197157 12:111033976-111033998 CGGCGGCGGCGGCGGCGCGGCGG + Intergenic
1102197158 12:111033979-111034001 CGGCGGCGGCGGCGCGGCGGCGG + Intergenic
1102457132 12:113077844-113077866 CGGCGGCAGCGGGGGCGCGGGGG - Exonic
1102854056 12:116277803-116277825 CGGCGGCGGCGGCGGCTCGCGGG + Intergenic
1102913594 12:116737261-116737283 CTTCTGCAGCGGCGCCGCCGGGG - Intronic
1103320005 12:120086970-120086992 CTACAGCCGCGGCGCAGCGCCGG - Intronic
1103400642 12:120640906-120640928 CGGCGGCGGCGGCGGCGAGCGGG + Exonic
1104658496 12:130591932-130591954 CTGGGGCAGTGGTGCAGCGCAGG - Intronic
1105578661 13:21674535-21674557 CGGCTGCAGGGGCGCCGCGGCGG + Intronic
1105578903 13:21675547-21675569 GTGAGGCCGCGGCGGCGCGCGGG - Intronic
1105698591 13:22915769-22915791 CCGCGGCAGAGGCGGCGCGCCGG - Intergenic
1110558510 13:76886251-76886273 CGGCGGCGGCGGCGGGGCGCAGG - Exonic
1112216256 13:97434108-97434130 CGGCGGCGGCGGCGGCGGGCGGG + Intergenic
1112461444 13:99606733-99606755 CTGCGGCGGCGGCGCTGCTGAGG + Exonic
1113530100 13:111018235-111018257 AAGCGGCAGGGGCGCGGCGCTGG - Intergenic
1113656165 13:112068737-112068759 CAGCGGCCGCGGCGCAGAGCCGG + Exonic
1115851785 14:37595144-37595166 CGGCGGCGGCGGCGGCGCGGCGG + Intronic
1116657971 14:47674991-47675013 CGGCGGCGGCGGCGGCGCGCTGG + Intergenic
1117913108 14:60652935-60652957 CTGCTGCTCCGGCGCCACGCCGG - Intronic
1118627767 14:67674742-67674764 CTGAGGGAGCGGTGCCGCGCCGG + Exonic
1118752436 14:68816727-68816749 CTGCAGCAGCGTCGGCTCGCCGG - Intergenic
1118776954 14:68979195-68979217 CTTCGCCAGCAGCGCCGCGGCGG - Exonic
1119539286 14:75428168-75428190 GGGCGGCAGCGGCGCGGAGCGGG + Intronic
1119759656 14:77141544-77141566 GTGCGGCGGCGGCGGCGCGGGGG - Intronic
1121758679 14:96424268-96424290 CGGCGGCAGCGGCGACACGGGGG + Intronic
1122081690 14:99271290-99271312 CGGCGGCAGCGGCGCGGCGGCGG - Intronic
1122183493 14:99971981-99972003 CGGCGGCGGCGGCGGGGCGCGGG - Intronic
1122214322 14:100193181-100193203 GAGCGGAAGCGGCGCCGCTCAGG - Intergenic
1122418402 14:101561074-101561096 CGGCGGCCGCCGAGCCGCGCCGG - Intergenic
1122602939 14:102930296-102930318 CCGCCGCTGCTGCGCCGCGCGGG + Exonic
1122620962 14:103057473-103057495 CTGCGGCGGCGGCGGCGGGGAGG - Intergenic
1122672856 14:103385448-103385470 CGGCGGCAGCGGCGGCCAGCAGG + Intronic
1122787781 14:104171863-104171885 CTGCAGCAGTGGCGGCTCGCCGG - Exonic
1122921790 14:104883331-104883353 CTGCGCCAGCGGCGGCCCCCGGG + Exonic
1122975290 14:105168436-105168458 CGGCGGCGGCGGGGCCGGGCGGG - Exonic
1123033208 14:105460814-105460836 CTGCGGCACCAGCGCCGAGATGG - Exonic
1124323674 15:28737986-28738008 CTCCTGCAGCGCCGCCTCGCCGG - Intronic
1124637091 15:31372198-31372220 ATGCTGCAGCGGCGCGGCGGGGG + Exonic
1124957179 15:34367176-34367198 CAGCGGCGGCGGCGGCGCTCTGG + Exonic
1125200755 15:37099075-37099097 CGGCGGCAGCGGCGCAGCAGCGG + Intronic
1126299987 15:47184555-47184577 CTGCGCCGGCCGCGGCGCGCCGG - Intronic
1128247406 15:66142578-66142600 CTGTGGCAGCTGCGCCAGGCTGG - Intronic
1128841468 15:70854229-70854251 CGGCGGCGGCGGCGCGGGGCGGG - Intronic
1129675973 15:77632626-77632648 CGGCGGCGGCGGCTCCGGGCCGG - Intronic
1129710598 15:77818784-77818806 CTAGGCCCGCGGCGCCGCGCTGG - Intronic
1130317682 15:82810136-82810158 CTCCTGCAGCGCCGCCTCGCCGG - Exonic
1131735475 15:95326962-95326984 CGGCGGCTGCGGCGCTCCGCGGG + Intergenic
1132365124 15:101251562-101251584 CGGCGGCGGCGGCGCTGCCCGGG - Exonic
1132559920 16:589004-589026 CTGCGGCAGCCGGGCCCGGCAGG + Intergenic
1132741310 16:1414650-1414672 CGGCGGCAGCGGCGCTGAGCGGG - Exonic
1132815975 16:1826739-1826761 CCGCCGCAGCCTCGCCGCGCTGG - Exonic
1132843553 16:1990019-1990041 CAGCGGCAGCGGCCTCGGGCGGG + Exonic
1132844079 16:1992075-1992097 CTGCCGCTTCGGCGTCGCGCTGG + Exonic
1132885105 16:2179053-2179075 CGGCGGCGGCGGCGGCTCGCGGG + Exonic
1134172081 16:11976762-11976784 CAGCGGCGGCGGCGCGGCGCAGG + Exonic
1135016163 16:18926432-18926454 GTGCGACAGCGGCGGCGCGGCGG - Exonic
1137285702 16:47014226-47014248 CTGGGCCAGCGGCGGCGCGTGGG - Intergenic
1137714812 16:50592214-50592236 CGGCGGCAGCAGCAACGCGCTGG - Intronic
1137788530 16:51155363-51155385 AGGCGGCAGCGGCGCCCCGGGGG + Intergenic
1139778186 16:69330242-69330264 ATGCGGCGGCGGCGCTGCGTGGG - Exonic
1139917836 16:70439126-70439148 CGGCGGCGGCGGCGGCGCTCGGG - Intronic
1140223113 16:73058195-73058217 CGGCGGCGGCGGCGCGGGGCCGG + Intronic
1141079304 16:81036303-81036325 CAGCGGCAGCGGCAGCGCGCAGG - Intronic
1141533363 16:84661862-84661884 GTGCAGCAGCGGCGCCACGCGGG - Exonic
1142271791 16:89093787-89093809 CCGCCGCCACGGCGCCGCGCCGG + Exonic
1142350153 16:89576028-89576050 CTGCTGCAGCAACGCCACGCTGG - Exonic
1142376801 16:89710803-89710825 CTGGGGCCGCGGGGCTGCGCTGG + Exonic
1142395347 16:89828565-89828587 CAGCTGCGGCGGCGCCGCGGCGG + Exonic
1142421357 16:89972516-89972538 GCGCGGCAGGGGCGCGGCGCCGG - Exonic
1142429686 16:90019408-90019430 CTGCGGCAGCGACTCGGCCCCGG + Intronic
1142799711 17:2337553-2337575 CGGCGGCGGCGGCGGCGGGCCGG + Exonic
1143030263 17:3963826-3963848 CAGCGGGAGCGGCGCGGCGTTGG + Intronic
1143527217 17:7479586-7479608 CGGCGGCAGCGGGGCCGGGCCGG - Intronic
1144840505 17:18183098-18183120 CGGCGGCAGCGGCGGCAGGCTGG + Intronic
1144910054 17:18673029-18673051 CGGCGGCGGCGGCGGCGCCCGGG - Exonic
1144953185 17:19004747-19004769 CTGCGGCGGCGGCGCGAGGCTGG + Exonic
1146057675 17:29589379-29589401 CTGCGGCCGCGTCGCCGCTGAGG - Exonic
1146492383 17:33292272-33292294 CGGCAGCGGCGGCGCCGGGCGGG - Exonic
1147672404 17:42184215-42184237 CCGAGGCAGGGGCGCGGCGCTGG + Exonic
1147907640 17:43833193-43833215 CTGCGGCTGCCGCGCCGGGCGGG + Intergenic
1150311056 17:64129899-64129921 CCGGGGCAGCGTCGCGGCGCCGG - Intronic
1151558697 17:74859897-74859919 CGGCGGCGGCGGCTCCGGGCGGG + Intronic
1152433119 17:80260542-80260564 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433132 17:80260572-80260594 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433145 17:80260602-80260624 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433158 17:80260632-80260654 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433171 17:80260662-80260684 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433184 17:80260692-80260714 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433197 17:80260722-80260744 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433210 17:80260752-80260774 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433223 17:80260782-80260804 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433236 17:80260812-80260834 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152544114 17:80992177-80992199 CGGCAGCCACGGCGCCGCGCAGG - Intronic
1152570555 17:81119626-81119648 CTGTGGGAGCGGGGCCGGGCCGG - Intronic
1152628650 17:81399799-81399821 CGGCGGCAGCGGCGCTGCGGTGG - Exonic
1153480537 18:5543216-5543238 CTGGGGCAGCGGCCCCCGGCCGG - Intronic
1155392722 18:25352309-25352331 CGGCGGCGGCGGCGGCGGGCGGG - Intergenic
1156171764 18:34494069-34494091 CTGCTGCCGCGGCGCCGCTCGGG + Intronic
1156788123 18:40939835-40939857 CTGCGGCAGCCGCGCAGGGCTGG - Intergenic
1157279117 18:46334232-46334254 CGGCGGCGGCGGCTGCGCGCGGG - Exonic
1161077268 19:2291867-2291889 TGGCGGCAGAGGCGCCGCGGAGG - Exonic
1161212743 19:3076096-3076118 CGGCGGCACGGGCGCCGCGTGGG - Intergenic
1161703243 19:5805935-5805957 CGGCGGCGGCGGCGGCGAGCAGG - Intergenic
1161854034 19:6753607-6753629 GTGCGGCAGCGCCACCTCGCCGG + Exonic
1162141005 19:8585566-8585588 CCGCGGCAGAGACGCGGCGCTGG + Exonic
1162470914 19:10871633-10871655 CGGCGGCAGCGGCGGCGGCCTGG + Exonic
1163167599 19:15508617-15508639 GCGCGGCCGCGGCGCTGCGCTGG + Intronic
1165422114 19:35727501-35727523 CTGGGGCAGCGCAGCCCCGCTGG + Exonic
1166888066 19:45973478-45973500 CGGCGGCTGCGGGGCCGCGGAGG + Exonic
1167613295 19:50517552-50517574 CTGAGGCGGCGGGGCCGGGCGGG - Exonic
1168076329 19:53982552-53982574 CGGCGGCGGCGGCGCCGTGGGGG + Exonic
1168654701 19:58118486-58118508 CTGCGGCCACGGCCCCGCCCCGG - Intergenic
925927205 2:8678994-8679016 TGGCGGCGGCGGCGGCGCGCGGG - Exonic
927606575 2:24491529-24491551 CCGTGGCGGCGGCGCCGCCCCGG - Intergenic
929218222 2:39437500-39437522 CGGCGGCAGCGGCCGGGCGCGGG - Intergenic
931516315 2:63052348-63052370 CTGGGGCAGGGGCGCAGCCCTGG + Intronic
931614619 2:64143934-64143956 CCGCCGCAGCGGGGGCGCGCAGG + Intronic
934079068 2:88452325-88452347 CTGCGGCGGCGGCGGAGGGCGGG + Exonic
934566975 2:95346592-95346614 CGGCGGCGGCGGCGCGGCGGCGG - Intronic
934754651 2:96816660-96816682 CTGAGGAGGCGGCGCCGCCCTGG + Exonic
934966830 2:98731013-98731035 CGGCGGCAGCGGCGGCGCGCGGG - Intronic
936038366 2:109129901-109129923 ATCCGTCAGCGGCCCCGCGCGGG + Exonic
936122657 2:109760349-109760371 CGGCGGCGGCGGCGCAGGGCCGG + Intergenic
936122690 2:109760418-109760440 CGGCGGCGGCGGCGCAGGGCCGG + Intergenic
936222003 2:110611055-110611077 CGGCGGCGGCGGCGCAGGGCCGG - Intergenic
936222036 2:110611124-110611146 CGGCGGCGGCGGCGCAGGGCCGG - Intergenic
936278726 2:111120775-111120797 CGGCGGCCGCGGCGCCGAGGGGG + Intronic
937221451 2:120345101-120345123 CGGCGGCGGCGTCCCCGCGCCGG - Intergenic
937309673 2:120894364-120894386 CTGAGTCAGCGGAGCCACGCCGG - Intronic
939629759 2:144517166-144517188 CGGCGGCGGCGGCGGCGCCCAGG - Intronic
940382595 2:153033064-153033086 CAGCGGCAGCGGCTCCAGGCAGG - Intergenic
940918901 2:159286583-159286605 CTGCAGGAGCGGGGGCGCGCGGG + Exonic
941666422 2:168247540-168247562 CGGCGGCGGCGGCGGCGGGCGGG - Exonic
941951584 2:171161161-171161183 CGGGGGCAGCGTCCCCGCGCCGG + Intronic
942241233 2:173965080-173965102 CGGCGGCAGCGGCCCCGGGCTGG + Intronic
942454804 2:176130336-176130358 CAGCGGCGGCGGCCCCGGGCGGG - Exonic
943185167 2:184598315-184598337 CTGCGGCAGCGGCGCCGCGCGGG + Intergenic
944048181 2:195437705-195437727 CAGCGGCAGCGGCAACCCGCGGG - Intergenic
944412444 2:199457729-199457751 CGGCGGCGGCGGCGGCGAGCCGG + Exonic
944696153 2:202202002-202202024 CTGCGGCGGCAGCGCCACTCAGG - Intergenic
944933630 2:204545548-204545570 CGGCGGCGGCGGCGGCGCACGGG - Intergenic
946329161 2:219000124-219000146 CTGTGGCAGCGGAGCAGCGGAGG + Intergenic
948698280 2:239745113-239745135 CTGCCGCAAAGGCGCAGCGCAGG - Intergenic
948805712 2:240452818-240452840 GTGCGGCTGCGGCGCTGCCCGGG + Intronic
948806067 2:240453816-240453838 CGGCGGCAGCGTCGCCGCCCTGG - Intronic
948824678 2:240568498-240568520 CGGCGGCGGCGGCGGGGCGCGGG - Intronic
948945700 2:241217977-241217999 CGGGGGCAGCGGGGGCGCGCAGG + Intronic
1169915006 20:10674846-10674868 CTGCGGCCGGGGCGTCGGGCCGG - Intergenic
1170756808 20:19212494-19212516 CTGGGGCGGCGGCGCGGCGGGGG - Intergenic
1170999145 20:21396406-21396428 CGGCGGCAGCCGCTCCGCGAAGG - Exonic
1172474484 20:35226750-35226772 CCGGGGCGGCCGCGCCGCGCCGG + Exonic
1172962188 20:38806825-38806847 GCGCGGCAGCGGCGCAGCCCTGG - Intronic
1173166250 20:40689003-40689025 CTGGGGACGCGGCGGCGCGCCGG + Exonic
1173322257 20:41998695-41998717 CCAGGGCTGCGGCGCCGCGCAGG - Intergenic
1173930221 20:46811597-46811619 CGGCGCCATCTGCGCCGCGCAGG - Intergenic
1176194599 20:63831372-63831394 CCGCGGCCGGGGCGCGGCGCGGG - Intergenic
1176207232 20:63895534-63895556 CTGCGGGAGCCGGGCCGGGCCGG + Intronic
1176548594 21:8212224-8212246 CGGCGGCGGCGGCGCGGCCCCGG - Intergenic
1176556251 21:8255724-8255746 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176556488 21:8256432-8256454 CGGCGGCGGCGGCGCGGCCCCGG - Intergenic
1176567525 21:8395259-8395281 CGGCGGCGGCGGCGCGGCCCCGG - Intergenic
1176575190 21:8438766-8438788 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176575427 21:8439474-8439496 CGGCGGCGGCGGCGCGGCCCCGG - Intergenic
1177431707 21:20998302-20998324 CGGCGGCAGCAGAGCCGGGCGGG - Exonic
1179225059 21:39445747-39445769 CTGCGCCAACGCCGCAGCGCCGG + Intronic
1179775525 21:43659536-43659558 AGGCGGCGGCGGCGGCGCGCGGG - Exonic
1180559059 22:16601410-16601432 GAGTGGCAGCGGCGGCGCGCGGG + Intergenic
1180649969 22:17369548-17369570 CTGCGGCTGCGGCTGCCCGCGGG - Exonic
1180949415 22:19714472-19714494 CGGCGGCGGCGGCGGCGCGGAGG + Exonic
1181230130 22:21417244-21417266 CTGCGGGGGCGGGGCCGGGCCGG - Intergenic
1181248519 22:21517622-21517644 CTGCGGGGGCGGGGCCGGGCCGG + Intergenic
1181458151 22:23070941-23070963 CTGCGGGAGCGGCGCTGAGGCGG + Intronic
1182355309 22:29720172-29720194 CAGCGGGGGCGGCGCCGCTCTGG - Exonic
1184037635 22:41926246-41926268 CAGGGGCAGCGCCGCCTCGCCGG + Exonic
1184037648 22:41926288-41926310 CTGCGGCTGCAGCGCCGTCCTGG + Exonic
1184650941 22:45919228-45919250 CGGCGGCAGCAGCGGCACGCCGG - Intergenic
1185255107 22:49827496-49827518 CCGCGGCCGCGGCGCCCCGAAGG - Intronic
1185345062 22:50307420-50307442 CGGCGGCTGCGGCTCCGCGGAGG - Intronic
1203253239 22_KI270733v1_random:127821-127843 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1203261294 22_KI270733v1_random:172902-172924 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1203261532 22_KI270733v1_random:173607-173629 CGGCGGCGGCGGCGCGGCCCCGG - Intergenic
949969961 3:9396603-9396625 CGGCGGCCGCGGCTCCGCCCCGG - Intergenic
950153827 3:10707986-10708008 CAGCCGCAGCGGGGCCGGGCCGG - Intronic
951485287 3:23203240-23203262 CGGCGGCAGCGGCGGCGCTGAGG + Intronic
951558834 3:23945941-23945963 CTGAGGCGGCGGCGGCGGGCGGG + Intronic
951898383 3:27632898-27632920 CGGAGGCAGCGGCGGCGCGGAGG - Intergenic
951898387 3:27632915-27632937 CGGAGGCAGCGGCGGCGCGGAGG - Intergenic
951898391 3:27632932-27632954 CGGAGGCAGCGGCGGCGCGGAGG - Intergenic
951898395 3:27632949-27632971 CGGAGGCAGCGGCGGCGCGGAGG - Intergenic
952382970 3:32818565-32818587 CTGCGGGAGTGGCGGCGCGGAGG - Exonic
954110227 3:48429408-48429430 CGGCGGTGGCAGCGCCGCGCGGG - Exonic
954403395 3:50331392-50331414 CTGCGGCTGCGGCTCCTGGCAGG - Exonic
954540758 3:51391728-51391750 CGGCGGCAGAGGAGACGCGCGGG - Exonic
955769595 3:62374073-62374095 CGGGGGCCTCGGCGCCGCGCAGG + Intronic
956414529 3:69013136-69013158 CCGCGGCTGAGACGCCGCGCTGG + Intronic
958470202 3:94507628-94507650 CCGCGGCAGAGCCGCAGCGCCGG + Intergenic
963236727 3:142963620-142963642 CTGCGGCAGCGGCGGCGGCGCGG + Exonic
963870689 3:150410393-150410415 CTGGGGCTGCTGCGCCGCGGGGG - Exonic
966883266 3:184361614-184361636 CTGCGCCAGCGGCGCCCGCCGGG - Exonic
967118195 3:186360941-186360963 AGGAGGCAGCGGCGCAGCGCGGG + Intronic
967930429 3:194686776-194686798 CGGCGGCGGCGGCGGAGCGCCGG - Exonic
968372819 4:11261-11283 CCGGGGCAGGGGCGCGGCGCAGG + Intergenic
968372829 4:11298-11320 CTCCCGCCCCGGCGCCGCGCCGG - Intergenic
968593695 4:1471992-1472014 CTGCGGCTGCGGCGCGCCACCGG - Intergenic
968674719 4:1871352-1871374 CTGCGGCGGCGGCGGCGGGCGGG + Intergenic
968850492 4:3074626-3074648 CGGCGGAGGCGGGGCCGCGCCGG - Intergenic
968879947 4:3293432-3293454 CCGCGGGGGCGGCGCCGGGCAGG + Intronic
968965151 4:3765940-3765962 CGGCGGCGGCGGCGCAGCTCCGG + Intergenic
969559809 4:7939760-7939782 CGGCGGCGGCGGCCCCGCCCCGG - Exonic
972960545 4:44447917-44447939 TGGCGGCGGCGGCGGCGCGCAGG - Exonic
973613762 4:52659585-52659607 CTGCGGCAGCCGCACCTCGCAGG + Intergenic
976184335 4:82429923-82429945 CCGCCGCAGCGGCTCCGCACTGG - Exonic
980063320 4:128155448-128155470 CTGCGGCCGGGGGGCTGCGCGGG - Intronic
981504108 4:145481723-145481745 CGGCAGCGGCGGCGGCGCGCGGG + Intronic
982110087 4:152045875-152045897 CGGCTGCAGCGGCTCCGCGCGGG - Intergenic
982288805 4:153759973-153759995 CTGCGGCGGCGGCGGAGCGGCGG + Exonic
985642019 5:1067927-1067949 CTGCGACTGCTGCGCCGGGCAGG - Intronic
985652096 5:1112028-1112050 CGGCGGGAGCGGCGCAGCGCGGG - Exonic
985896305 5:2751596-2751618 CGGCGGCAGCAGCGCGGAGCCGG + Exonic
986330579 5:6713838-6713860 CGGCGGCGGCGGCGGCGGGCGGG - Intergenic
990955056 5:61332424-61332446 CGGCGGCGGCGGCGGCGTGCGGG + Exonic
990955061 5:61332440-61332462 GTGCGGGGGCGGCGCGGCGCTGG + Exonic
992124516 5:73626555-73626577 CGGCGGCAGCTGCGGAGCGCGGG + Intronic
992374416 5:76174300-76174322 CTGCCGCTGCCGCGCCGCTCCGG + Intronic
993726944 5:91380209-91380231 CGGCGGCGGCGGCGGCGCGCGGG - Intronic
994353834 5:98773857-98773879 CGGCGGCAGCAGCGGGGCGCAGG - Intronic
997463447 5:134071259-134071281 CAGCGGGGGCGGCGCCGTGCGGG + Intergenic
997583981 5:135034037-135034059 CCGGGGCTGCGGCGCCGGGCGGG + Exonic
1001035090 5:168291778-168291800 CAGCGGCAGCGGCGGCGTGGAGG + Intronic
1001440303 5:171737761-171737783 CAGCGGCAGCGGTGGCGTGCTGG - Intergenic
1002897857 6:1389746-1389768 CGGCGGCGGCGGCGGCGGGCGGG - Intergenic
1002927247 6:1611570-1611592 CGGCGGCGGCGGCGGCGCGGGGG + Exonic
1003175899 6:3751980-3752002 CTGCGGCTCCGGGGCCGCGAGGG - Exonic
1003426026 6:5999053-5999075 CTGCGGCAGCGGCAACGGGGCGG - Exonic
1004690346 6:17987691-17987713 CGGCGGCGGCGGCGGCGGGCGGG + Intergenic
1006083588 6:31581246-31581268 CTGCGGGAGCCGAGCCGGGCCGG + Intronic
1006097591 6:31665703-31665725 CCTGGGCAGCAGCGCCGCGCCGG + Intronic
1006547493 6:34792049-34792071 GGGCGGCCGCGGCGCCGCGCTGG + Intronic
1006860744 6:37170289-37170311 GTGCGGCAGCGCCGCGGGGCAGG - Exonic
1007444647 6:41895437-41895459 TTGCGCCAACGGCGCAGCGCTGG + Intergenic
1007600140 6:43076280-43076302 CGGCGGCGGCGGCGGCGCGCGGG + Intronic
1010141923 6:72622254-72622276 CAGCGGCGGCGGCGGCGGGCGGG + Exonic
1010703266 6:79077625-79077647 CGGCGGCAGCGGCGGCGCAGCGG + Intronic
1011054758 6:83193387-83193409 CTGCGGCTGCGGTTCCGAGCGGG + Exonic
1015366356 6:132401491-132401513 GAGCGGCAGCGGCGGCGAGCGGG + Exonic
1017672399 6:156779257-156779279 CGGCGGCGGCGGCGGCGCGCTGG - Exonic
1017793637 6:157823069-157823091 CCGGGGCGGCGGCGCGGCGCGGG + Intronic
1018400359 6:163414736-163414758 CAGCGGCAGAGGCGCCGCGGCGG + Exonic
1018788981 6:167131584-167131606 CTGCAGCAGGGGCGCGGCTCTGG - Intronic
1019343754 7:519997-520019 CTGCCGCGGCGGCGGCGCCCGGG - Intronic
1019381651 7:727278-727300 CTGCAGCTGCGCCGCCGCCCTGG + Exonic
1019563955 7:1670597-1670619 CTGCGGCAGCGACCCCGACCCGG - Intergenic
1019989555 7:4682253-4682275 CGGCTGCAGCGGCGGCGCGGGGG - Intergenic
1020101050 7:5394633-5394655 CTGGGGCGGCGGCGCCTCCCTGG - Intronic
1020278205 7:6637239-6637261 CGGGGGCAGCGGCGCGGAGCGGG - Intergenic
1020278313 7:6637526-6637548 CGGCGGCGGCGGGGCCGGGCTGG + Intronic
1021827988 7:24573553-24573575 CGGCGGCAGCGGCGGCGCGGAGG + Exonic
1024965356 7:55019034-55019056 CTGCTGCGGCCGCGCTGCGCCGG - Intronic
1025078705 7:55964561-55964583 CGGCGTCAGCGGCGGCGCCCGGG + Exonic
1025608194 7:63054401-63054423 CTCCGGCGGCTGCGCCGCGGCGG - Intergenic
1025815109 7:64903664-64903686 CTGCGGCAGCAGAGCTGCCCAGG - Intronic
1026625499 7:71988407-71988429 CTGCGGCAGAGGCGGCTCTCAGG + Intronic
1026665675 7:72337740-72337762 CTGCGGCAGCCGTGCCTCCCTGG - Intronic
1027390276 7:77696898-77696920 CAGCGGCGGCGGCGGCGGGCAGG - Exonic
1027421152 7:78019482-78019504 CGGCGGCGGCAGCGGCGCGCTGG - Exonic
1028417578 7:90596342-90596364 GGGCGGCGGCGGCGCGGCGCGGG + Intronic
1028621431 7:92833340-92833362 CCGCCCCAGCGGCGCCGCGGCGG - Exonic
1028838064 7:95396473-95396495 CTGCGGCACCCGGGCCGCTCAGG - Intergenic
1029238742 7:99143836-99143858 CGGCGGCGGCGGGGCCGGGCCGG - Exonic
1029367631 7:100126942-100126964 CGGCCGAAGCGGCGCCGCGGAGG - Exonic
1029539016 7:101172264-101172286 CTTCGGTAGCGACGGCGCGCAGG - Exonic
1029813986 7:103075243-103075265 CCGCGGCAGAGCCGCAGCGCCGG - Exonic
1030138698 7:106284561-106284583 CGGCGGCGGCGGCGCGGCGGGGG - Intronic
1030262484 7:107580257-107580279 CGGCGGCCGCGGAGCAGCGCAGG + Intronic
1030884754 7:114922995-114923017 AGGCGGCAGCGGCGCGGCGCGGG + Exonic
1031406914 7:121396538-121396560 CCGCCGCAGCGGCCCTGCGCCGG + Intergenic
1033390725 7:140924837-140924859 CTCCGCCCGCGGCGCCGCCCGGG - Intergenic
1034147253 7:148884206-148884228 CGGCGGCGGCGGCGGCGCGCGGG - Exonic
1034469718 7:151248750-151248772 CGGCGGCGGCGGCGGCGGGCGGG - Exonic
1034483534 7:151341716-151341738 CGGCGGCGGCGGCGGCGCGAAGG + Exonic
1034560624 7:151877328-151877350 CTGGGGCCGCGGCGCGGCGGGGG - Intergenic
1034578930 7:152025936-152025958 CTGCGGCGGCGGCGGCGCGCGGG + Intronic
1034618259 7:152436597-152436619 GAGTGGCAGCGGCGGCGCGCGGG - Intergenic
1035096651 7:156361429-156361451 CTGAGGCAGGGGCGCCACCCTGG - Intergenic
1035581040 8:738986-739008 CGGCGGCGGCGGCGTCGCGCAGG - Intergenic
1035751631 8:2001148-2001170 CTGCGGAACCGGGGGCGCGCGGG + Exonic
1035751955 8:2002499-2002521 CCGGGGCAGCGGCGCCACGGGGG - Exonic
1037900998 8:22689709-22689731 CGGCGGCAGCAGCACCGCGTCGG + Exonic
1038484177 8:27921876-27921898 CTGCTGCTGAGGCGCCACGCGGG - Exonic
1039454603 8:37698407-37698429 CGGCGGCGGCGGCGCTGCCCAGG - Exonic
1040038840 8:42896762-42896784 CGGCGGCGGCGGCGGCGCGGCGG + Intronic
1041201645 8:55455263-55455285 CTGCGGCTGCGGCGGCGGCCCGG + Intronic
1041689928 8:60678796-60678818 CGGCGGCGGCGGCGGCGCGGGGG + Exonic
1041739004 8:61139241-61139263 CTGCCCCCGCGGCGCCTCGCGGG - Intronic
1044242389 8:89902493-89902515 CGGCGGCTGCAGCGGCGCGCGGG - Intronic
1044340420 8:91040752-91040774 CTGCGGCAGCGGCGGGGCCTGGG + Exonic
1049109664 8:140635298-140635320 CGGCGGCGGCGGGGCCGAGCCGG - Intronic
1049419659 8:142511092-142511114 CGGCGGGAGGGGCGCCGGGCAGG + Intronic
1049585299 8:143430160-143430182 CGGCGGCGGCGGCGGCGCGGGGG - Exonic
1049621237 8:143599220-143599242 CTGCGCCAGCGGCTCCCCGCTGG + Exonic
1049762273 8:144336902-144336924 CGGCGGCGGCGGCGGCGGGCGGG + Intergenic
1049791080 8:144473029-144473051 CTGCAGCAGCAGCACCGCGGTGG - Exonic
1051235373 9:14993375-14993397 CTGCGGCCCCGCCCCCGCGCCGG - Intergenic
1051289114 9:15527709-15527731 CGGCGGCTGCTGCGCGGCGCTGG + Intergenic
1051641801 9:19230672-19230694 CTGCGCCTGCGCCGCCTCGCGGG - Exonic
1052799573 9:32955701-32955723 CTGCGGCCGCTGCTCCGCCCAGG - Intergenic
1053643123 9:40106765-40106787 CGGCGGCTGCGGCGCAGCCCGGG + Intergenic
1053763027 9:41358724-41358746 CGGCGGCTGCGGCGCAGCCCCGG - Intergenic
1054541633 9:66269838-66269860 CGGCGGCTGCGGCGCAGCCCCGG - Intergenic
1056135167 9:83623502-83623524 AGGCGGCTGCGGGGCCGCGCAGG + Intronic
1056643196 9:88388346-88388368 CTGCGACGGCCGCGCCGCCCCGG - Intergenic
1057234236 9:93346198-93346220 CGGCCGCAGCGGCGCTGGGCTGG + Exonic
1057592354 9:96383566-96383588 CGAGGGCAGCCGCGCCGCGCCGG + Exonic
1058885781 9:109320501-109320523 CTGCCGCTGCGCCGCCGCCCGGG + Exonic
1059102464 9:111483769-111483791 CAGCGGCAGCGGCTCCGCAGAGG - Intronic
1059234700 9:112751324-112751346 CTGCGGCTGCGACCCCGCGGAGG - Intronic
1059414801 9:114155988-114156010 CGGCGGCGGCGGCGGCGCGCGGG + Exonic
1060209082 9:121699423-121699445 CGGCGGCGGCGGCGGCGCTCCGG - Exonic
1061089957 9:128420888-128420910 CTGGAGCAGCGGCGCGGCGCGGG - Exonic
1061208698 9:129178476-129178498 CTGGGGCTGCCGCGCCGCGCGGG + Intergenic
1061272255 9:129550171-129550193 CTGCGGCGGCGGCGCGGTCCGGG - Intergenic
1061541021 9:131277835-131277857 AGGCGGCAGCGGCGCGGCGGCGG - Intergenic
1061541084 9:131278045-131278067 CGGCGGCGGCGGCGGCGGGCGGG + Intergenic
1061987149 9:134136335-134136357 CCGCTGCAGCGGCCCCGCCCGGG + Intronic
1062022768 9:134326964-134326986 CAGCTGCAGCCGCGCCGCACAGG + Intronic
1062230608 9:135479821-135479843 CGGCGGCAGCGGCGGCGCGCGGG + Exonic
1062272233 9:135714807-135714829 CGGCGGCTGCGGGGGCGCGCGGG - Intronic
1062579177 9:137222007-137222029 CTGCGGCGGCGGCGCGCGGCCGG - Intergenic
1062596407 9:137301884-137301906 CTGCGTCTGCGGCGCGGAGCAGG + Exonic
1203469641 Un_GL000220v1:110968-110990 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1203469878 Un_GL000220v1:111676-111698 CGGCGGCGGCGGCGCGGCCCCGG - Intergenic
1203477462 Un_GL000220v1:154940-154962 CGGCGGCGGCGGCGCCGCCGCGG - Intergenic
1203477699 Un_GL000220v1:155648-155670 CGGCGGCGGCGGCGCGGCCCCGG - Intergenic
1186426088 X:9465199-9465221 CTGCGGCGGCGGCGGGGCGGGGG - Exonic
1189308837 X:40006268-40006290 CTCCGCCAGCGGCGCGGAGCTGG - Intergenic
1189324663 X:40105330-40105352 CTGCGGCGGCGGCGGCGGGGCGG - Intronic
1190050308 X:47144617-47144639 TGGCGGCAGCGGCGACGCGAGGG - Exonic
1190265696 X:48826384-48826406 CAGGGGCAGGGGCGCGGCGCAGG + Intergenic
1190285383 X:48957743-48957765 CGGCGGCGGTGGCGGCGCGCGGG + Intronic
1195702541 X:107716148-107716170 CGGCGGCAGCAGCGCTGAGCCGG - Intronic
1199772596 X:150984039-150984061 CGGCGGCGGCGGCGCCGGGCGGG - Intronic
1200047804 X:153411794-153411816 CTGCGGCGGCGGCGACAAGCAGG + Intergenic
1200098202 X:153673901-153673923 CTGCGGCGCCGCGGCCGCGCTGG - Intronic