ID: 943188578

View in Genome Browser
Species Human (GRCh38)
Location 2:184646770-184646792
Sequence AGAGGTTTGCCTAGGCACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943188578_943188586 20 Left 943188578 2:184646770-184646792 CCTCCGTGCCTAGGCAAACCTCT No data
Right 943188586 2:184646813-184646835 CTGTATTCTCCCTTTGGCACTGG No data
943188578_943188585 14 Left 943188578 2:184646770-184646792 CCTCCGTGCCTAGGCAAACCTCT No data
Right 943188585 2:184646807-184646829 CAGACACTGTATTCTCCCTTTGG No data
943188578_943188582 -10 Left 943188578 2:184646770-184646792 CCTCCGTGCCTAGGCAAACCTCT No data
Right 943188582 2:184646783-184646805 GCAAACCTCTGAGCGCTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943188578 Original CRISPR AGAGGTTTGCCTAGGCACGG AGG (reversed) Intronic
No off target data available for this crispr