ID: 943191289

View in Genome Browser
Species Human (GRCh38)
Location 2:184682021-184682043
Sequence AGAGGGGGCTGAGGCGGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943191289_943191303 9 Left 943191289 2:184682021-184682043 CCCCTGCCGCCTCAGCCCCCTCT No data
Right 943191303 2:184682053-184682075 GGCACCAACAAGCTTAGGGAGGG No data
943191289_943191300 4 Left 943191289 2:184682021-184682043 CCCCTGCCGCCTCAGCCCCCTCT No data
Right 943191300 2:184682048-184682070 CTTTGGGCACCAACAAGCTTAGG No data
943191289_943191301 5 Left 943191289 2:184682021-184682043 CCCCTGCCGCCTCAGCCCCCTCT No data
Right 943191301 2:184682049-184682071 TTTGGGCACCAACAAGCTTAGGG No data
943191289_943191306 22 Left 943191289 2:184682021-184682043 CCCCTGCCGCCTCAGCCCCCTCT No data
Right 943191306 2:184682066-184682088 TTAGGGAGGGAGACCAGTGAGGG No data
943191289_943191305 21 Left 943191289 2:184682021-184682043 CCCCTGCCGCCTCAGCCCCCTCT No data
Right 943191305 2:184682065-184682087 CTTAGGGAGGGAGACCAGTGAGG No data
943191289_943191302 8 Left 943191289 2:184682021-184682043 CCCCTGCCGCCTCAGCCCCCTCT No data
Right 943191302 2:184682052-184682074 GGGCACCAACAAGCTTAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943191289 Original CRISPR AGAGGGGGCTGAGGCGGCAG GGG (reversed) Intronic
No off target data available for this crispr