ID: 943191296

View in Genome Browser
Species Human (GRCh38)
Location 2:184682036-184682058
Sequence GGTGCCCAAAGTTTCAGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943191296_943191305 6 Left 943191296 2:184682036-184682058 CCCCCTCTGAAACTTTGGGCACC No data
Right 943191305 2:184682065-184682087 CTTAGGGAGGGAGACCAGTGAGG No data
943191296_943191306 7 Left 943191296 2:184682036-184682058 CCCCCTCTGAAACTTTGGGCACC No data
Right 943191306 2:184682066-184682088 TTAGGGAGGGAGACCAGTGAGGG No data
943191296_943191303 -6 Left 943191296 2:184682036-184682058 CCCCCTCTGAAACTTTGGGCACC No data
Right 943191303 2:184682053-184682075 GGCACCAACAAGCTTAGGGAGGG No data
943191296_943191308 23 Left 943191296 2:184682036-184682058 CCCCCTCTGAAACTTTGGGCACC No data
Right 943191308 2:184682082-184682104 GTGAGGGCTGAGTCTTCGCATGG No data
943191296_943191309 24 Left 943191296 2:184682036-184682058 CCCCCTCTGAAACTTTGGGCACC No data
Right 943191309 2:184682083-184682105 TGAGGGCTGAGTCTTCGCATGGG No data
943191296_943191301 -10 Left 943191296 2:184682036-184682058 CCCCCTCTGAAACTTTGGGCACC No data
Right 943191301 2:184682049-184682071 TTTGGGCACCAACAAGCTTAGGG No data
943191296_943191302 -7 Left 943191296 2:184682036-184682058 CCCCCTCTGAAACTTTGGGCACC No data
Right 943191302 2:184682052-184682074 GGGCACCAACAAGCTTAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943191296 Original CRISPR GGTGCCCAAAGTTTCAGAGG GGG (reversed) Intronic