ID: 943191297

View in Genome Browser
Species Human (GRCh38)
Location 2:184682037-184682059
Sequence TGGTGCCCAAAGTTTCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943191297_943191306 6 Left 943191297 2:184682037-184682059 CCCCTCTGAAACTTTGGGCACCA No data
Right 943191306 2:184682066-184682088 TTAGGGAGGGAGACCAGTGAGGG No data
943191297_943191309 23 Left 943191297 2:184682037-184682059 CCCCTCTGAAACTTTGGGCACCA No data
Right 943191309 2:184682083-184682105 TGAGGGCTGAGTCTTCGCATGGG No data
943191297_943191308 22 Left 943191297 2:184682037-184682059 CCCCTCTGAAACTTTGGGCACCA No data
Right 943191308 2:184682082-184682104 GTGAGGGCTGAGTCTTCGCATGG No data
943191297_943191302 -8 Left 943191297 2:184682037-184682059 CCCCTCTGAAACTTTGGGCACCA No data
Right 943191302 2:184682052-184682074 GGGCACCAACAAGCTTAGGGAGG No data
943191297_943191305 5 Left 943191297 2:184682037-184682059 CCCCTCTGAAACTTTGGGCACCA No data
Right 943191305 2:184682065-184682087 CTTAGGGAGGGAGACCAGTGAGG No data
943191297_943191303 -7 Left 943191297 2:184682037-184682059 CCCCTCTGAAACTTTGGGCACCA No data
Right 943191303 2:184682053-184682075 GGCACCAACAAGCTTAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943191297 Original CRISPR TGGTGCCCAAAGTTTCAGAG GGG (reversed) Intronic
No off target data available for this crispr